Labshake search
Citations for Roche :
801 - 850 of 7151 citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... minced and digested in DMEM containing collagenase D (0.75U/ml, Roche) and dispase II (1.0U/ml ...
-
bioRxiv - Genomics 2020Quote: ... and digested with 5.4 U/mL collagenase D (Roche applied science), 100 U/mL DNase I (Sigma ...
-
bioRxiv - Physiology 2019Quote: The pericardia were enzymatically digested with 1mg/ml Collagenase D (Roche) for 35 minutes at 37°C in RPMI 1640 (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... the specimen was digested in 8 mg/mL Collagenase D (Roche) and 4.8 U/mL Dispase II (Roche ...
-
bioRxiv - Immunology 2019Quote: ... Murine omenta were enzymatically digested with 1mg/ml Collagenase D (Roche) for 35 minutes at 37°C in RPMI 1640 (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor fragments were digested with Collagenase D and DNase I (Roche), counted and 2×106 BC004 cells were injected in total volume of 20 µl PBS into the mammary fat pad of humanized NSG mice ...
-
bioRxiv - Cell Biology 2021Quote: ... and digested with collagenase D (5 mg/mL, #11088882001, Roche, Germany) and dispase (2 mg/mL ...
-
bioRxiv - Immunology 2020Quote: ... were teased and digested in 2.68 mg/ml collagenase D (Roche) for 25 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... and then enzymatically digested with collagenase D (0.5 mg/mL, Roche) and DNAse I (0.01 mg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and digested overnight in 0.2% (wt/v) Collagenase D (11088866001, Roche) in DMEM-F12 medium supplemented with 1% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... cut into small pieces and treated with collagenase-D (Roche, Merck). After 30 minutes of incubation at 37 ° C ...
-
bioRxiv - Microbiology 2023Quote: ... and then enzymatically digested with collagenase D (0.5 mg/mL, Roche) and DNase I (0.01 mg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µL of homogenate were treated with (i) collagenase D (Roche) high (40U/mL ...
-
bioRxiv - Immunology 2024Quote: ... kidneys were enzymatically digested with 400 µg/ml collagenase D (Roche) and 10 U/ml DNase I (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2019Quote: ... 4 °C) the cleared supernatants were diluted 1 time using water containing 1x cOmplete ™ EDTA-free protease inhibitor (Roche). Protein extract was incubated overnight with anti-HA antibodies (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... bovine serum albumin in TBS-T and incubated for 16 h at 4°C: mouse anti-GFP (1:1000) (Roche), sheep anti-CK1α (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4°C with anti-Digoxigenin antibody coupled to alkaline phosphatase (Roche, 11207733910, used at 1/4000). The last day ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the soluble fraction was incubated for 1 h at 4°C with beads crosslinked to mouse anti-GFP antibody (Roche). Resulting Immunoprecipitates were washed three times with lysis buffer and protein eluted with RapiGest surfactant (Waters ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
Elevated Hoxb5b expands vagal neural crest pool and blocks enteric neuronal development in zebrafishbioRxiv - Developmental Biology 2021Quote: ... Probed embryos were blocked for 1-2 hours at ambient temperature in 5% Goat sera in PBST before detection overnight (∼16 hours) at 4°C using an anti-Digoxigenin-Fab fragments conjugated to Alkaline Phosphatase enzymes (1:1000 dilution, Roche) in 5% Goat Sera in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... the sections were incubated overnight at 4 °C in digoxigenin antibodies conjugated to horseradish peroxidase (anti-digoxigenin-POD; Fab fragment; 1:100; Roche), rinsed in TBS (0.1 M Tris-HCl with 0.9% NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated overnight at +4 °C with the antibody anti-digoxigenin-AP Fab fragment (#11093274910, Roche, 1:1000) diluted in blocking solution in a humidity chamber ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at 4°C with primary antibody for rat anti-HA (1:200; 12013819001, RRID:AB_390917, Roche, Basel, Switzerland), rabbit anti-GFP (1:200 ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated overnight at 4°C with sheep anti-DIG alkaline phosphatase conjugated antibody (1:2,000; Roche Applied Sciences). Sections were washed thrice with PTW buffer and twice with coloration buffer (100 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-Green Fluorescent Protein overnight at 4°C (Clones 7.1 and 13.1; 1:50 dilution, Roche, Mannheim, Germany) and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10 ...
-
bioRxiv - Immunology 2020Quote: ... Bacterial pellets obtained by centrifugation at 13,500g for 10 min at 4°C were resuspended in 1 ml of PBS containing protease inhibitors (cOmplete Mini, Roche; 1 tablet per 10 ml of PBS following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Cell Biology 2022Quote: ... isolated from each cell line was collected by centrifugation (30 000 x g, 4°C, 10 min) and resuspend in 1 x PBS supplemented with protease inhibitors (Roche) to protein concentration 1.5 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sonicated samples were centrifuged and the supernatant (soluble fraction) was incubated for 1 h at 4°C with beads crosslinked to anti-GFP antibody (11814460001; Roche) or to M2 anti-FLAG antibody (F1804 ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed once with PBS and resuspend with Tris-HCl containing 4 mM EDTA and 1× complete protease inhibitor cocktail (Roche). Dounce homogenizer is used to fractionate the cell membranes and then 3 min 600 g centrifugation was used to obtain Post-Nuclear Supernatants (PNS) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in PBS for 30 min and incubated overnight at 4°C with 1:1,500 anti-HA high affinity (Roche, 3F10). After three PBS washes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Genomics 2023Quote: One hundred mg of 14-day-old seedlings were ground and nuclei were isolated with 4°C Buffer (0,25M Sucrose, 10mM Tris-HCl, 10mM MgCL2, 1% Triton, 5mM ß- mercaptoethanol) containing proteinase inhibitor cocktail (Roche) and filtered in 63 µm ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...