Labshake search
Citations for Roche :
8201 - 8250 of 8835 citations for FH1 FH2 domain containing protein 1 FHOD1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The pelleted nuclei were resuspended in 1 ml ice cold shearing buffer (10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate, 0.1% SDS, 1x Roche cOmplete protease inhibitors). Buffer compositions for LB1 ...
-
bioRxiv - Microbiology 2020Quote: ... 24 hours post infection cells lysed using NP-40 buffer (50 mM Tris, 150 mM NaCl, 1% Nonidet P-40, and Complete Mini protease inhibitor cocktail [Roche]). Insoluble material were removed by centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 for 48h the cells were washed twice with PBS and then lysed in PBS/1% NP40 including the cOmplete protease inhibitor cocktail 2 (Roche) and phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... two volumes of RIPA buffer supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Science) was added to one volume of packed worms ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with BaseMuncher nuclease (Expedion; 1 ml per 40 ml cell suspension) and Complete EDTA-free protease inhibitor mix (Roche). The extract was precleared by centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM NaF and 1 mM Na3VO4) in the presence of complete EDTA-free protease inhibitor cocktail (Roche Life Science) for 20 min at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: Round spermatids enriched by STA-PUT were lysed with 1% Triton X-100 in PBS supplemented with EDTA-free protease inhibitor cocktail (Roche) by gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5% glycerol with the addition of 1 EDTA-free cOmplete protease inhibitor cocktail tablet per 50 mL lysate (Roche). Cells were lysed by sonication on ice with stirring and the lysates were clarified by centrifugation at 20,000 g for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: Harvested cells were resuspended in lysis buffer (50mM Tris-Cl pH 7.5, 150mM NaCl, 1mM MgCl2, 1% NP40) supplemented with protease inhibitor (Roche 11836170001) and phosphatase inhibitor cocktail (Sigma P5726 ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were washed with cold 1x PBS three times and before scrapping the samples in cold lysis buffer (50 mM Tris pH 7.6, 200 mM NaCl, 1% Triton X-100, 0.5% CHAPS + complete protease inhibitor/Roche Cat# 11836153001). The samples were mechanically disrupted by passing them through a 27.5 syringe five times before sonication on ice (1 sec on ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Neuroscience 2021Quote: ... Both NIB and IP Buffer were supplemented with an EDTA-free cOmplete protease inhibitor cocktail tablet (1 tablet/28 ml; 11873580001, Roche) and RNasin Plus RNase inhibitor (0.2% ...
-
bioRxiv - Genetics 2021Quote: Animals were resuspended in lysis buffer (50 mM Tris/HCl pH 7.4, 100 mM NaCl, 1% v/v SDS, complete protease inhibitor cocktail (Roche Diagnostics)) ...
-
bioRxiv - Immunology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.1% SDS and 1%Triton X-100 and protease inhibitors cocktail (Mini-Complete EDTA-free; Roche Applied Science, Penzberg, Germany). Lysates were centrifuged (13000g ...
-
bioRxiv - Biochemistry 2021Quote: Cells confluent in a 15-cm dish were washed by PBS buffer three times before being lysed on plate with 1 mL ice-cold NP-40 lysis buffer supplemented with protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... digested using 0.1 % papain at 37°C for 10 min and for 5 additional minutes in presence of DNAse1 (1 mg/ml, Roche). After stopping papain activity by adding MC+ media ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed using the same lysis buffer as used for the ribosome profiling experiment with 1× protease inhibitor cocktail (Roche), omitting cycloheximide ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed once with PBS and resuspended in ice-cold WCE buffer (10 mM Tris-HCl, 1% NP-40, 2 mM MgCl2, benzonase, cOmplete Protease Inhibitor Cocktail (Roche), 25 nM NEM where relevant ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50 mM NaCl, 50 mM sodium pyrophosphate, 50 mM sodium fluoride, 1% Triton-X-100, 10% glycerol, 5 mM EDTA, Roche MiniProtease Inhibitor cocktail tablet ...
-
bioRxiv - Microbiology 2022Quote: Lungs were perfused with sterile PBS and digested at 37°C for 1 h with 625 μg/mL collagenase D (Roche) and 75 U/mL DNase I (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were washed with ice-cold PBS and scraped into lysis buffer (1 mM EPPS, 8 M urea, protease (complete mini, EDTA-free) inhibitors (Roche) and PhosSTOP phosphatase inhibitor (Roche)) ...
-
bioRxiv - Neuroscience 2023Quote: ... Five P2 mouse brains were homogenized in 5 mL of homogenization buffer (5 mM Tris-HCl, 0.32 M sucrose, 1 mM MgCl2) supplemented with EDTA-free protease inhibitors (cOmplete™, Roche), then centrifuged at 1,660 x g for 15 min at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Cancer Biology 2022Quote: Frozen bacteria pellets were thawed on ice and loosened in 25 mL lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1% Triton X100, 10 mM DTT, 1X Protease Inhibitor Cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted, resuspended in HSB (PBS supplemented with 150 mM NaCl, 1 mM DTT, protease inhibitor cocktail Complete (Roche)) ...
-
bioRxiv - Immunology 2022Quote: ... Following 79 μL of 50 mM Tris-HCl was added together with 1 μL of 100x protease inhibitor cocktail (Roche) before the probe sonicated with VibraCell probe (Sonics & Materials ...
-
bioRxiv - Molecular Biology 2023Quote: Thawed and washed cell pellets were lysed in 1 mL sterile PBS with 10% (v/v) glycerol and 1x cOmplete mini protease inhibitor cocktail (Roche). Ten micrograms of protein were separated by SDS-PAGE and transferred to a nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 1 ml of the buffer required for each particular application (see below) and supplemented with protease inhibitors (Roche), and then disrupted by sonication ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM MgCl2 and 1 mM DTT supplemented with DNase I (10 µg/ml) and complete protease inhibitor cocktail tablets (Roche). Complex formation was initiated by adding synthesized Stachel peptide (100 µM ...
-
bioRxiv - Pathology 2023Quote: ... Spain) (1:10000) for 1.5h in darkness was followed by the addition of HRP substrate (11112422001, Roche Applied Science, Germany). Absorbance was measured using NanoQuant Infinite M200 Pro multi-plate reader (Tecan ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in PBS for 30 min and incubated overnight at 4°C with 1:1,500 anti-HA high affinity (Roche, 3F10). After three PBS washes ...