Labshake search
Citations for Roche :
751 - 800 of 1110 citations for Rnase 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Microbiology 2019Quote: ... were transfected with 20 ng pNF-□B-Luc and 3 ng pRL-TK using FuGENE 6 (Roche). Transfected cells were incubated for 24 h (37°C ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Genomics 2023Quote: Mastermix 3 (IS-PCR) was freshly prepared and contained 12.5 μl Kapa HiFi Hotstart Readymix (2x, Roche), 0.25 μl IS PCR Primers (10 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ng ds-cDNA was processed for library construction using KAPA Hyper Prep Kit (Kapa Biosystems #KK8504) according to the standard protocol except that a 15-min USER enzyme (BioLab # M5505L ...
-
bioRxiv - Bioengineering 2022Quote: A total of 3 µL of AAV was treated with 20 units of DNase I (Roche #04716728001) at 37°C for 45 min to remove residual DNA in vector samples ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were homogenized 3 x 30s at 7000 power in a MagnaLyzer® (Roche Diagnostics, Basel, Schweiz) and placed on ice for ∼1 minute between each homogenization ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM NaCl, 3 mM MgCl2, 0.5 mM spermidine, 0.2 mM spermine, 0.01% Triton-X, 1x Roche complete protease inhibitors ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 3 hours with Anti-Digoxigenin-AP Fab fragments (dilution 1:3000) (Roche, 11093274910) at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell extracts were obtained by washing 3 × in PBS and either lysing for RNA (TriPure reagent, Roche) or protein extraction (50 mM Tris-HCl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...