Labshake search
Citations for Roche :
751 - 800 of 10000+ citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2021Quote: ... which was suspended into 1 ml cold Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and 5 μl Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: A subcutaneous dose (1 or 2 mg/kg of weight) of diazepam (DZPM, Valium ®, Roche; México) or saline solution (SAL ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with 1 ml lysis buffer (0.5 % Nonident-P40, 2 % protease inhibitor cocktail (Roche, Switzerland) and 1 % phosphatase inhibitor cocktails I and II (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... were lysed in 100 µL or 300 mL RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% IGEPAL CA-630, 0.25% Na-deoxycholate, 2 mM EDTA, 0.1% SDS, Roche cOmplete™ Mini protease Inhibitor Cocktail) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM tris(2-carboxyethyl)phosphine (TCEP) and protease inhibitor (cOmplete EDTA-free Protease Inhibitor Cocktail, Roche)) ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.15% NP40, 1 x Complete protease inhibitors, Roche) and rotated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with the primers listed in the section above ...
-
bioRxiv - Developmental Biology 2022Quote: ... The incorporation of BrdU was then measured by ELISA at 24h per the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... Template DNAs of interest (500 ng each) were transcribed in vitro during 2 hours at 37°C using SP6 RNA polymerase kit (Roche), followed by a 1 hr treatment with DNAse I (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Immunology 2022Quote: ... qPCRs were performed using specific primers for each gene (Supplementary Table 2) in Roche LightCycler 480 real-time PCR machine using Lightcycler 480 Sybr Green I Master kit (Roche). Actin was used as a reference gene (Supplementary Figure 1) ...
-
bioRxiv - Microbiology 2020Quote: The cell viability of circPSD3 siRNA treated cells was determined at day 2 post-transfection using Cell Proliferation Kit I (MTT, Roche) as previously described [59].
-
bioRxiv - Molecular Biology 2019Quote: ... 2 µg of total RNA was converted to a sequence library using a KAPA Stranded mRNA-seq Kit (KAPA Biosystems). These libraries were analyzed using a HiSeq 2500 sequencer (Illumina ...
-
bioRxiv - Genomics 2020Quote: Barcoded 2×300 bp metagenomic libraries were prepared with the KAPA Hyperplus Library Preparation kit (KAPA Biosystems, Wilmington, MA, US) and sequenced on an Illumina MiSeq system at the National Oceanography Centre (Southampton ...
-
bioRxiv - Cancer Biology 2021Quote: The in vitro synthesis of digoxigenin (DIG)-labeled antisense SatIII probe (158 bp SatIII repeat cloned in 1μg of PGEM-2-98 construct) with T7 RNA polymerase was carried out using the DIG labeling kit from Roche Products Pvt ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using Lightcycler 480 SYBR Green 1 Master Kit (Roche). PCR amplification was performed as follows ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viability assay was performed using a WST-1 assay kit (Roche). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...