Labshake search
Citations for Roche :
751 - 800 of 5210 citations for Phthalic Acid Unlabeled 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 0.5 mg/ml dispase (Roche) and 0.1 mg/ml DNase-I (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... 50 μg/ml hygromycin (Roche) or 30 μg/ml streptomycin (Sigma) ...
-
bioRxiv - Genetics 2022Quote: ... + 0.25mg/ml tRNA (Roche 10109517001)) for at least 1 hour at 4°C with rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... + DNase (0.05 mg/mL) (Roche) for 30 minutes at 37 °C in constant orbital agitation ...
-
bioRxiv - Immunology 2022Quote: ... 200 μg/ml DNaseI (Roche) and 2 mg/ml collagenase 8 (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... 1.25mg/ml Collagenase D (Roche), 1mg/ml Dispase (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.075 mg/ml Liberase (Roche). After manually disaggregation with a clean razor blade and incubation at room temperature for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... 1U/mL of dispase (Roche), and 100U/ml DNase I (Sigma ...
-
bioRxiv - Biophysics 2019Quote: ... 120 μg/ml catalase (Roche), and aged 1.5 mM 6-hydroxy-2,5,7,8-tetramethyl-chromane-2-carboxylic acid (Trolox ...
-
bioRxiv - Biochemistry 2019Quote: ... 40 μg/mL catalase (Roche), 1 mM cyclooctatetraene (COT ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10U/ml DNaseI (Roche). Cells were then filtered through a 70 μm filter (Miltenyi Biotec) ...
-
bioRxiv - Immunology 2020Quote: ... 20 μg/mL DNAse1 (Roche) and placed on ice until further processing (~1 g tissue/10 mL) ...
-
bioRxiv - Neuroscience 2019Quote: ... 3mg/mL Dispase II (Roche), and 1mg/mL Trypsin Inhibitor (Sigma-Aldrich ...
-
bioRxiv - Physiology 2019Quote: ... 14μg/ml of insulin (Roche), 30μg/ml of transferrin (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... FBS/2mM EDTA/1.2mg/mL Collagenase D (Roche)/1mg/mL DNase I (Roche) at 37°C for 20 minutes with agitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.2 mg/ml DNase (Roche) in PBS with MgCl2 and CaCl2 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... collagenase IV (1.75mg/mL; Roche) and DNase I (0.5mg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100ug/ml DNase I (Roche) and 2 mM CaCl2 for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... 40µg/mL DNase I (Roche)) for 1h at 37°C under constant agitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.25 mg/ml lysozyme (Roche), EDTA-free protease inhibitor (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... and 0.4mg/ml DNaseI (Roche) in HBSS plus 5% fetal bovine serum and 10mM HEPES ...
-
bioRxiv - Immunology 2021Quote: ... and 50ug/ml Liberase (Roche). Thymi were digested in 37°C water bath with mechanical aid by pipetting through a glass Pasteur pipette every 4 minutes ...
-
bioRxiv - Immunology 2021Quote: ... with 100ug/ml DNase (Roche) and 50ug/ml Liberase (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... with 100ug/ml DNase (Roche) and 50ug/ml Liberase (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 50 μg/ml DNaseI (Roche), and 0.1% (wt/vol ...
-
bioRxiv - Immunology 2020Quote: ... 1mg/ml collagenase A (Roche) and 0.4mg/ml DNase I (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... transferrin (150□mg/ml, ROCHE), ascorbic acid (50□mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... or hygromycin (125ug/mL, Roche). Neural monolayer differentiation was performed as outlined in (Ying et al. ...
-
bioRxiv - Physiology 2022Quote: ... 10 µg/ml leupeptin (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Immunology 2022Quote: ... 10ng/mL TGF-β (Roche), 0,5% O2 or NaCl / KCl as indicated)..
-
bioRxiv - Synthetic Biology 2022Quote: ... 0.17 mg/mL tRNA (Roche), 0.4 mM NAD ...
-
bioRxiv - Immunology 2022Quote: ... Phytohemagglutinin (PHA, Roche; 5μg/ml) was used as a positive control ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.5mg/ml DNase (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Laminin 0,2 μg/ml (Roche), Culture 1 1% (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... and DispaseII (Roche, 1mg/ml) and minced before placing on thermocycler at 37C for 1h at 1000rpm ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.2LJmg/mL DNase I (Roche) and 4% Trypsin (0.25% in Tris Saline ...
-
bioRxiv - Biophysics 2024Quote: ... 2170 U/ml catalase (Roche) and 3 mM Trolox (Sigma)) ...
-
bioRxiv - Biophysics 2024Quote: ... 2170 U/ml catalase (Roche) and 3 mM Trolox (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg/ml Bevacizumab (Roche) was administered ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (0.3 μg/ml, Roche) was used for nuclear staining ...
-
bioRxiv - Cell Biology 2024Quote: ... 20mg/mL dispase II (Roche), 0.3μM calcium ...
-
bioRxiv - Genomics 2024Quote: ... protease inhibitor cocktail ml(Roche); and SUPERaseIn RNase Inhibitor (Ambion)] ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 μg/ml Insulin (Roche), 25 ng/ml bFGF (Corning ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2mg/mL collagenase (Roche). Following digestion and three subsequent PBS washes ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.525mg/ml collagenase D (Roche), 5 unit/ml Dispase (Stemcell Technologies ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... 10 µg/ml insulin (Roche), 0.5 µg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... laminin (5 µg/ml, Roche), bovine collagen I (30µg/ml ...
-
bioRxiv - Immunology 2024Quote: ... 12,5 μg/ml DNAse (Roche), and 1% FBS (Bodego ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1mg/ml collagenase D (Roche) and 25µg/ml DNase 1 (THermo Fisher Scientific)) ...