Labshake search
Citations for Roche :
751 - 800 of 6330 citations for Oxytocin ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 5 mM Tris-HCl (pH 7.4) supplemented with Protease Inhibitor cocktail (Roche, #04693159001) and transferred to a 7 mL Dounce tissue grinder (KIMBLE KONTES ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a 5 μl reaction mixture of DNA SYBR Green I Master (Roche) according to the standard manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48.384g for 45 min at 4°C ...
-
bioRxiv - Systems Biology 2024Quote: ... then 5 min at 62°C) with KAPA HiFi HotStart Ready Mix (Roche). Libraries were quantified by Bioanalyzer (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% glycerol) containing a protease inhibitor cocktail tablet (Complete EDTA-free, Roche Diagnostics) and gently stirred for 30 min in the presence of 0.2 mg/mL lysozyme (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... 5% glycerol) supplemented with Complete Mini protease inhibitor mixture tablet (Roche Applied Science) and 10 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Genetics 2023Quote: ... Each reaction consisted of 5 μL LightCycler 480 SYBR Green Master mix (Roche), 0.5 μL each of the forward and reverse primers (100 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.6 with KOH) containing 5 mg ml−1 collagenase (type A, ROCHE). Defolliculated oocytes were injected with 50 ng mRNAs of mixed GlyT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Immunology 2024Quote: ... Cell nuclei were stained with 5 µg/ml of DAPI (10236276001, Roche Diagnostics).
-
bioRxiv - Immunology 2023Quote: ... 5 mM EDTA] supplemented with 1x protease inhibitors (Mini Protease Inhibitor Tablets, Roche). Total protein concentration was determined by BSA Protein Assay Kit (Thermo Life) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNase free kit (Roche). RNA amount was quantified and cDNA was prepared using TaqMan Reverse Transcription Reagents (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by library preparation with KAPA RNA HyperPrep kit (Roche, kit code KK8541), according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... at pH 7.4] and seeded at a density of 50–75 × 103 cells/plate on laminin (Roche) coated plates ...
-
bioRxiv - Microbiology 2020Quote: Square plates containing standard Middelbrook 7H10 OADC agar were prepared and supplemented with kanamycin (Roche,20ug/ml), with or without anhydrotetracycline (ATc ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time PCR reactions were performed in 96-well plates on a Light Cycler II 480 (Roche) device ...
-
bioRxiv - Plant Biology 2019Quote: ... Each cDNA sample was amplified in duplicate on a single 96-well optical plate using LightCycler480 (Roche). The cycling profile consisted of 95°C for 10 min followed by 40 cycles of 15 s at 95°C and 60 s at 60°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The plate was sealed and heated in a real-time PCR system (Light Cycler 480, Roche diagnostic) from 20°C to 80°C in increments of 0.5°C/minute ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative PCR (qPCR) was performed in triplicate using a 96-well plate-based (Roche Diagnostics, Penzberg, Germany) in a Thermal Cycling StepOnePlus (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... as per manufacturer’s instructions in 96-well plates and conducted in a LightCycler 480 Instrument II (Roche). Primers used in the study (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... Plates were then washed and developed with 50 μL of POD 3,3’,5,5’-tetramethylbenzidine (TMB) substrate (Roche) for 5 min and stopped with 50 μL of 1 M H2SO4 ...
-
bioRxiv - Immunology 2022Quote: ... All the qPCR reactions were performed in a 96-well plate on Lightcycler 480II (Roche™, Germany) and data normalized to GAPDH and β-Actin ...
-
bioRxiv - Microbiology 2022Quote: ... at a 1:1 ratio in a MagNA Pure 96-well deep-well extraction plate (06241603001, Roche), covered with a MagNA Pure Sealing Foil (06241638001 ...
-
bioRxiv - Plant Biology 2023Quote: ... in 384-wells plates with a total volume of 10 uL using Light Cycler 480 apparatus (Roche). mRNA abundance was compared to two reference genes EXP (AT4G26410 ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR followed the Lightcycler 480 SYBR Green I Master mix product manual for 384 multiwell plates (Roche). All primers are listed in Supplemental Table S7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... QPCRs were performed using a 96-well plate qPCR machine (Stratagen) with SYBR green with ROX (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... proliferation was measured using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells were pulsed with 10μM BrdU ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and protease inhibitor cocktail (Roche cat. no. 04693124001) and phosphatase inhibitor (Roche cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Neuroscience 2021Quote: Zebra finches received intramuscular (I.M.) injections of 2-Bromo-5’-deoxyuridine (BrdU; Roche Diagnostics) in 0.05 M tris buffered saline (TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... in an IP buffer (1xPBS, 5% glycerol, 0.5 mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tab per 5 ml (Roche, 0463159001), 40 U RNaseOUTTM (Thermo Fisher 10777019 ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μl of KAPA SYBR Fast RT-qPCR solution (Kapa Biosystems, Inc., Woburn, MA), 0.5 μl of 10 μM forward and reverse primers ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated at 55 °C overnight with 5 µL proteinase K (Roche). Genomic DNA was extracted with phenol:chloroform extraction.
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... 300 nM gene-specific primers and 5 µL SYBR Green Mix (Roche, Mannheim, Germany). Amplification was done using StepOneTM Real-Time PCR System according to the manufacturer’s description (Applied Biosystems ...