Labshake search
Citations for Roche :
751 - 800 of 10000+ citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 1 WFIKKN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... containing a protease inhibitor cocktail (Roche) and phosphatase inhibitors (AG Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... containing an antiprotease cocktail (Roche Diagnostic). Cells were incubated for 20 minutes on a rotating wheel ...
-
bioRxiv - Neuroscience 2022Quote: ... containing protease and phosphatase inhibitors (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... D6750)] containing protease inhibitor cocktail (Roche, 04693159001) and phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... containing proteinase and phosphatase inhibitors (Roche), centrifuged for 10 min at 8,000 × g at 4°C and supernatant extracted and stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche #4693159001) and PhosSTOP (Roche #4906837001 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing collagenase P (Roche, Penzberg, DE) (0.2 U/mL ...
-
bioRxiv - Microbiology 2021Quote: ... containing protease inhibitors (Roche Applied Science). Cell lysates were normalized for protein content with Pierce 660nm Protein Assay (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); centrifuged at 12,000 rpm for 10 min at 4 °C to get rid of cell debris ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 4693159001). Lysates were placed on ice for 30 minutes followed by sonication for 2 minutes with 10 seconds on/off cycle and centrifugation for 10 minutes at 10000g at 4°C in a microcentrifuge ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing protease inhibitor (Roche, Basel, Switzerland) and phosphatase inhibitor (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... containing DIG DNA-labelling mix (Roche) and primers DENV-1 3’UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG ...
-
bioRxiv - Pathology 2021Quote: ... containing complete mini protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing protease inhibitors (cOmplete tablets; Roche) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); protein concentrations were determined by BCA assay ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 0.8U/ml Liberase TM (Roche) and 1mg/ml DNAse (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing a protease inhibitor cocktail (Roche). Equal amounts of proteins were resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) containing protease inhibitors (Roche) and phosphatase inhibitors (5mM sodium fluoride ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor (Roche, Basel, Switzerland). The resultant lysates were centrifuged at 6000 rpm for 10 mins ...
-
bioRxiv - Systems Biology 2021Quote: ... pH 8.0) containing protease inhibitor (Roche) for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche 11697498001), then incubated on ice for 45 minutes with occasional gentle agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Protease inhibitors (Roche, cat# 04693159001) and Phosphatase inhibitors (Thermo Fisher Scientific ...
-
CREB5 reprograms nuclear interactions to promote resistance to androgen receptor targeting therapiesbioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 11836145001). Cells were then sonicated with a Covaris sonicator to yield DNA fragments averaging around 3000 nucleotides ...
-
bioRxiv - Cell Biology 2021Quote: ... containing cOmplete protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (Nacalai ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing cOmplete protease inhibitor cocktail (Roche) and PMSF (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... containing 1x protease inhibitor (5892970001, Roche), 1x phosphatase inhibitor (4906837001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing complete protease inhibitor cocktail (Roche). Lysed cell suspensions were rotated in 4°C for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing cOmplete Protease Inhibitor Cocktail (Roche), PhosSTOP phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 μM zanamivir (GSK ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... containing “Complete” protease inhibitor cocktail (Roche) for 15 min on ice with occasional mixing ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 μM zanamivir (GSK ...
-
bioRxiv - Immunology 2022Quote: ... containing protease inhibitor cocktail (Roche, 589297001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5% NP40 containing proteasome inhibitors (Roche). Lysates were analyzed by SDS-PAGE using standard techniques ...
-
bioRxiv - Immunology 2023Quote: ... containing 250 μg/ml liberase (Roche) and 100 μg/ml DNase I (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1% SDS) containing protease inhibitors (Roche) and phosphatase inhibitors (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing DAPI (0.5 µg/ml; Roche).
-
bioRxiv - Pathology 2023Quote: ... containing complete TM protease inhibitors (Roche). Samples were incubated on ice for 1 hour and centrifuged at 18,000 x g for 30 minutes at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... containing 0.3% BSA (fraction V; Roche), 10 mM HEPES (Corning) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing protease inhibitors (cOmplete Tablets, Roche) in gentleMACS M tubes using a gentleMACS dissociator (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing a protease inhibitor cocktail (Roche) and benzonase (Thermofisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... containing a protease inhibitor cocktail (Roche) and 25 mM β-Glycerophosphate ...
-
bioRxiv - Cell Biology 2023Quote: ... containing Complete Protease Inhibitor Cocktail (Roche). After centrifugation at 100,000 × g at 4 °C for 16 h ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 8.0) containing protease (Roche, 05892970001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... containing protease inhibitors (Roche Diagnostics GmbH) and 0.2 mM PMSF (phenylmethylsulphonyl fluoride ...
-
bioRxiv - Physiology 2023Quote: ... containing protease inhibitor cocktail (11697498001, Roche) and phosphatase inhibitor cocktail (4906845001 ...
-
bioRxiv - Immunology 2023Quote: ... containing 1mg/mL dispase II (Roche). The separated epidermis was then laid upon cell culture medium (RPMI-1640 medium supplemented with 10% fetal calf serum ...
-
bioRxiv - Microbiology 2023Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 µM zanamivir (GSK ...
-
bioRxiv - Cell Biology 2023Quote: ... containing complete mini protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RNA from cell culture and mouse heart tissue was extracted using high pure RNA isolation kit (Roche, 11828665001) and miRNeasy Mini kit (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... RNA from mouse brainstem or primary cell cultures was isolated using the High Pure RNA Isolation Kit (Roche). HiPSC-derived cells were lysed in RLT Plus buffer (Qiagen ...