Labshake search
Citations for Roche :
751 - 800 of 3704 citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Cell Biology 2019Quote: ... with ATP standard solutions used at concentrations between 10−8 and 10−5 M (luciferin/luciferase ATP bioluminescence assay kit CLSII, Roche, Basel, Switzerland). Data are expressed as nmol ATP produced/min/106 cells.
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was isolated by isopropanol precipitation of cells and tumor lysates (lysis buffer was Tris [pH 8] 100 mM, EDTA 5 mM, SDS 0.2%, NaCl 200 mM, and 1 mg/mL proteinase K [Roche Diagnostics, Mannheim, Germany]) and resuspended in Tris/EDTA (TE ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell pellets were resuspended in approximately five volumes of lysis buffer (50 mM NaH2PO4 pH 8, 1 M NaCl, 10 mM Imidazole, 2 mM PMSF and protease inhibitor cocktail (Roche #4693132001). Cells were lysed by sonication on ice for 12 x 30 seconds at 30 W with one minute on ice in between ...
-
bioRxiv - Physiology 2022Quote: ... 2 mM EDTA, 20 mM Tris pH 8, 150 mM NaCl, 1 mM PMSF, 1X cOmplete™ Protease Inhibitor Cocktail, Roche) was added to the fragmented chromatin ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were fixed with 4%PFA and 100 μl of Annexin-V-Alexa 568 labeling solution (Roche) and 50 μM Sytox Green dye (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were incubated overnight at 4°C with a 1:2000 dilution of anti-digoxigenin antibody (Roche) in blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 15 minutes with 4 μL of X-treme Gene HP DNA transfection reagent (Roche). Transfected cells were selected for by hygromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...
-
bioRxiv - Microbiology 2021Quote: ... 16S variable region 4 (V4) amplifications were carried out using the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems) and barcoded primers 515F and 806R50 ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were probed overnight at 4 °C with anti-GFP primary antibodies (Roche 11814460001; 1:1000) and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson Immunoresearch # 115-035-146 ...
-
bioRxiv - Biophysics 2021Quote: ... liposomes (final lipid concentration = 1 mM) were blocked with 4% (w/v) fatty-acid-free BSA (Roche) in HK buffer for one hour at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... Then samples were incubated overnight at 4°C with the following antibodies: anti-HA clone 3F10 (Roche) or anti-M57 clone M57.02 (Center for Proteomics ...
-
bioRxiv - Pathology 2021Quote: ... Then hearts were perfused and digested with perfusion buffer plus 0.067 mg/ml Liberase Blendzyme 4 (Roche) for 30min ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated overnight at 4°C with 1:4000 alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) in buffer 2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellet was washed 4 times in PBS containing cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Protein samples were mixed with 4X LDS buffer containing DTT (NuPAGE™ Thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µg of genomic DNA in total was amplified by using Kapa HiFi HotStart ReadyMix (Roche KK2602). For external PCR step ...
-
bioRxiv - Neuroscience 2022Quote: ... Following an overnight incubation at 4 °C with rat anti-HA (1:500, monoclonal, Roche, Cat # 11867423001) or mouse anti-GAPDH (1:25.000 ...
-
bioRxiv - Immunology 2022Quote: ... was incubated for 30m at 4 °C and detection was achieved using UltraView DAB detection kit (Roche). Protein expression was scored by a board-certified pulmonary pathologist blinded to cohort status or treatment group ...
-
bioRxiv - Microbiology 2023Quote: ... The IVT reactions were incubated at 37 °C for 4 h and digested with DNase I (Roche). RNA was purified by denaturing PAGE ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The samples were then incubated overnight at 4°C with anti-fluorescein-POD (1:2000, Roche, #11426346910).
-
bioRxiv - Pathology 2023Quote: ... After addition of 4% sodium phosphotungstic acid in 170 mM MgCl2 and protease inhibitors (Complete-TM, Roche), extracts were incubated at 37 °C for 30 minutes and centrifuged at 18,000 x g for 30 minutes at 25 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... + 4% fetal bovine serum (FBS, Hyclone) and 0.01 mg/mL insulin-transferrin-sodium-selenite solution (ITSS; Roche) as previously described 28,29 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... IHC single- and multiplex-staining were performed on 4 µm sections using the Discovery ULTRA stainer (Roche). Antibodies and dilutions are provided in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) the lysate was transferred to 50 μl HA bead slurry (anti-HA affinity matrix, Roche) or 30 μl c-myc bead slurry (EZview red anti-c-myc affinity gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were dissociated using collagenase B (Roche) and cultured in low cluster plates to allow EB formation in in RPMI 1640 base media (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... 4.6 mg Collagenase B (Roche, Basel, Switzerland) and 2 mg/ml Actinomycin D (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were dissociated using collagenase B (Roche) and cultured in low cluster plates to allow EB formation in serum-free differentiation SFD media supplemented with BMP4 (3 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Collagenase B (CAT No: 11088815001) from Roche; CsCl (CAT No ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...
-
bioRxiv - Systems Biology 2019Quote: ... 25ml of pre-warmed to 37°C EGTA buffer followed by 25ml of pre-warmed to 37°C EBS buffer with 2.3U of Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) were cannulated into the vena cava ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... The cytotoxic potential of the samples was determined from THP1-cell supernatants after 3 hours by using the Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... lungs were removed and single-cell suspensions of lung mononuclear cells were prepared by Liberase Blendzyme 3 (70 ug/ml, Roche) digestion containing DNaseI (30 µg/ml ...