Labshake search
Citations for Roche :
751 - 766 of 766 citations for 6 Chloro 3 formylchromone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...