Labshake search
Citations for Roche :
751 - 800 of 3592 citations for 3 5 Diacetoxy 2 acetoxymethyl 6 phenethyl tetrahydro pyran 4 yl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of DNase I (Roche), and 1 μl of RNase OUT (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mg/ml collagenase D (Roche), and 1.5 mg/ml DNase I (Roche ...
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL] ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL solution] at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...
-
bioRxiv - Immunology 2020Quote: ... + 2 U/mL DNAse I (Roche), shaking at 200 rpm for 45 mins – 1 hour at 37 °C ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... collagenase D (2 mg/mL, Roche) and Dnase I (0.2 mg/mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... in 2% blocking solution (Roche 11096176001) were used for RNA probe detection ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL collagenase A (Roche), and 2 mg/mL collagenase D (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2× complete protease inhibitor cocktail (Roche, Sigma/Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of DNase I (Roche) treated RNA was converted to cDNA using BioScript Reverse Transcriptase (Bioline ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 “Complete” protease inhibitor tablets (Roche), 25 μg/mL lysozyme (Gold Biochem ...
-
bioRxiv - Genetics 2023Quote: ... and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Immunology 2022Quote: ... IL-2 (50 IU/ml) (Roche) and glucose (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 cOmplete Protease Inhibitor tablets (Roche)) ...
-
bioRxiv - Immunology 2024Quote: ... Liberase TL (2 U/ml; Roche) and DNAse1 (160 U/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% pronase (Roche, Basel, Switzerland). Cells were passed through a 70 μm cell strainer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... #2 and #ref were from Roche.
-
Decreased Astrocytic CCL5 by MiR-324-5p Ameliorates Ischemic Stroke Injury via CCR5/ERK/CREB PathwaybioRxiv - Neuroscience 2024Quote: ... 2 μg/μl CCL5 antibody (Roche), or 20 ng/μl recombinant mouse CCL5 (Absin) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2× HotStart Ready Mix (Roche, KK2601) was used for PCR amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... 2×cOmplete Protease Inhibitor Cocktail (Roche), and 1% n-dodecyl-β-maltoside (DDM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 cOmplete EDTA-free Protease Inhibitor Cocktail tablets (Roche), 500 U benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mL of Red Blood Cell Lysis Buffer (Roche) were added before being gently rocked for 10 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.4%) + Proteinase-K 4 mg/ml (Roche, 3115887001) and incubated for 2h at 55°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x PhosStop® phosphatase inhibitors (Roche), 4 μL of 20x cOmplete® protease inhibitors (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x cOmplete® protease inhibitors (Roche) and 1.6 μL of 1 M DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche). After centrifugation at 400g for 5 min at 40C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...