Labshake search
Citations for Roche :
701 - 750 of 6350 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... mouse α-GFP (clones 7.1 and 13.1, Roche, Switzerland) and rabbit α□HA (polyclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... monoclonal anti-GFP mouse IgG (Roche, 11814460001, 1:5000), polyclonal anti-Hexokinase 1 rabbit IgG (United States Biological ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and mouse anti-GFP (clones 7.1 and 13.1, Roche) at a dilution of 1:3000 for blots exposed to film ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-GFP (mouse monoclonal, Clone 7.1, 11814460001, ROCHE, Sigma); anti-RFP (rat monoclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were probed with mouse anti-GFP (Roche, 11814460001), rabbit anti-Cdc2 (CDK1 ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... mouse IgG monoclonal anti-GFP (Ref 11814460001, LOT42903200, Roche), diluted 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-GFP (1:500, monoclonal Anti-GFP, Roche), rabbit anti-GFP (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... mouse monoclonal anti GFP IgG (catalog number 11814460001; Roche), rabbit polyclonal anti tubulin IgG (catalog number SC-9104 ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated with 1:400 mouse anti-GFP IgG (Roche) for 1 hr at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:1000 mouse monoclonal anti-HA (3F10; Roche, 11867423001), 1:1000 rabbit polyclonal anti-RPN1 (abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... Blots were developed with GFP mouse antibody from Roche Applied Science (Indianapolis ...
-
bioRxiv - Cancer Biology 2019Quote: ... fixed and incubated with primary monoclonal mouse antibodies (Roche) that recognize bound BrdU in the DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (Roche, 11814460001, 1/10.000 for WB), goat anti-CTSB (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal anti-GFP was from Roche (Indianapolis, IN). All secondary antibodies used for immunoblotting were Near-InfraRed fluorescent conjugates (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2019Quote: ... primary antibodies mouse anti-GFP (Roche 11814460001, 1:500) and rabbit anti-BiP MRA-1246 (BEI resources (1:100 ...
-
bioRxiv - Genetics 2020Quote: ... Primary antibodies were anti-HA (12CA5) mouse (Roche, 11583816001) and anti-Smt3 (y-84 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-GFP (Roche Diagnostics Cat. No. 11814460001), Donkey anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP clones 7.1 and13.1 (Sigma Roche: 118144600010), 1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or anti-mouse horseradish peroxidase (HRP) (760–4313, Roche) secondary antibodies and the Discovery ChromoMap DAB kit reagents (760–159 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-α2δ-1 Abs (polyclonal, Roche, Cat # C5105) at 1:1000 or with mouse anti-GAPDH (1:25;000 ...
-
SLC15A4 favors inflammasome function via mTORC1 signaling and autophagy restraint in dendritic cellsbioRxiv - Immunology 2022Quote: ... mouse monoclonal anti-GFP was from Roche (Indianapolis, IN); rabbit anti-mTOR (7C10) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-GFP antibody (1:200, Roche, # 11814460001, Germany), TRITC-conjugated goat anti-rat antibody (1:200 ...
-
bioRxiv - Biochemistry 2022Quote: ... GFP was detected with mouse anti-GFP antibodies (Roche), GAPDH was detected with rabbit anti-GAPHD (Genetex) ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-GFP antibodies (1:500; 11814460001, Roche Diagnostics), anti-Nav1.1 antibodies (1:10,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-HA (12CA5 mouse monoclonal antibody, Roche, 1:10.000), anti-Ubiquitin (P4D1 mouse monoclonal antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2021Quote: ... For protein extraction cells were resuspended in protein extraction buffer (1xPBS, 10% glycerol, 1mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail), and lysed in a bead beater ...
-
bioRxiv - Cell Biology 2021Quote: ... along with the appropriate antibody (mouse HA 12CA5, 7.5 μl 0.4 mg/ml, Roche; mouse M2 FLAG, 5 μl 1 mg/ml, Sigma), before incubating at 4 °C on a rotating wheel at 14 rpm for 15-18 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Protein extract was incubated overnight with anti-HA antibodies (Roche). After over-night incubation ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatants were incubated with 30 µl Protein G-Agarose (Roche) per ml lysate for 1 hour at 4 °C and washed three times with lysis buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by incubation with Protein G Agarose beads (Roche, 1124323301) (15μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 μl bed volume of Protein A Agarose (Roche 11134515001) was added the following day to each sample ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitations were performed using Protein G Agarose beads (Roche, 1124323301) or anti-FLAG (M2 ...
-
bioRxiv - Genetics 2022Quote: ... 40 μl of protein G agarose beads suspension (Roche 11243233001) (settled beads volume 20 μl ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were visualized by Lumi-Light Plus detection reagent (Roche).
-
bioRxiv - Microbiology 2021Quote: ... 100 µl of protein G-coupled agarose bead resin (Roche) were washed (2 × CL buffer 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... proteins were digested with 200 ng trypsin (Roche, Basel, Switzerland) shaking at 600 rpm at 37°C for 17 hours ...
-
bioRxiv - Cell Biology 2020Quote: GFP-fusion proteins were detected using a monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: Proteins were extracted using RIPA buffer (Thermo) and proteinase (Roche) plus phosphatase (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Resuspended protein samples were digested with endoproteinases Lys-C (Roche) and trypsin (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were digested by adding trypsin (proteomics grade, Roche) at a 1/50 enzyme/protein ratio (w/w ...
-
bioRxiv - Molecular Biology 2024Quote: ... The proteins were digested by adding trypsin (proteomics grade, Roche) at a 1/50 enzyme/protein ratio (w/w ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pre-cleared with protein A-agarose beads (Roche, Germany). Primary antibody incubations were carried out for 2 hours at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were detected with anti-HA antibody (Roche, Cat#11867423001).
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...