Labshake search
Citations for Roche :
701 - 750 of 1493 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Plant Biology 2020Quote: ... 0.2% IGEPAL and 5 mM EDTA) and supplemented with a protease inhibitor cocktail (Roche diagnostics). Samples were centrifuged at 2,350 g for 10 min at 4°C and the supernatant was collected ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM sodium pyrophosphate) containing 0.05% PMSF and EDTA-free Complete protease inhibitor cocktail (Roche). Equal volume of acid washed 0.45 mm glass beads (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 5% glycerol) containing 100 mM Phenylmethylsulphonylfluoride (PMSF) and EDTA-free Protease inhibitor cocktail tablets (Roche). Resuspended cells were first treated with 1 mg/ml Lysozyme to digest the cell wall and subsequently frozen at −80°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... consisting of MS1 with 300 mg/L carbenicillin and 5 mg/L hygromycin (Roche, Germany) (YFT1-CDS) ...
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.5 μl DNA Pol Mix (5 U/μl, Expand Long Template PCR System, Roche Diagnostics), 27.25 μl PCR HPLC Gradient Grade H2O and 1 μl template (primary WTA product) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 2ME [pH 7.5]) supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) for 20 minutes on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA) and freshly added PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001). Equal amounts of protein (30 μg ...
-
bioRxiv - Cell Biology 2019Quote: ... ATP 5 mM) supplemented with proteases and phosphatase inhibitors (cOmplete EDTA-free and PhosSTOP, Roche). Cells were homogenized in a ball homogenizer with 10 μm clearance ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... S.p.a) and midazolam (0,5 mg kg −1) (Dormicum®, 5 mg/ml, Roche Pharma, Switzerland) for IM premedication before the start of the procedure ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: ... Samples were blocked in MABT containing 5% horse serum and 1% Western Blocking Reagent (Roche). In situ signals were developed as previously reported ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA diluted 1:5 in water was quantified using either SYBR Green I (Roche, # 04707516001) and a LightCycler 480 (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM TCEP and 5 % glycerol) supplemented with cOmplete EDTA-free protease inhibitor complex (Roche) and ribonuclease A (Roche) ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Genomics 2021Quote: ... Final libraries were PCR-amplified during 5 cycles with Kapa HIFI PCR kit (Roche, Basel, Switzerland) before standard library quality control with standard sensitivity NGS Fragment kit (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...