Labshake search
Citations for Roche :
701 - 750 of 3395 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol and 2 protease inhibitor cocktail tablets (cOmplete, EDTA free, Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% sodium dodecyl sulfate (SDS)] supplemented with complete protease inhibitor cocktail (Roche Diagnostics Corp. ...
-
bioRxiv - Genomics 2024Quote: ... Each PCR reaction contained 26.25Lμl 2× KAPA HiFi HotStart master mix (Roche), 2.5Lμl of 10LμM TruSeq RPIX primer (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μL of 2× Sybr Green (LightCycler 96, Roche Molecular Systems, Inc.), 200 nM of each primer ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μl of 10 mg/ml DNase (Roche, catalog no. 10104159001) and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 mM DTT) supplied with EDTA-free protease inhibitor cocktail (Roche). The lysis was performed using homogenizer EmulsiFlex-C3 (Avestin) ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Neurons were lysed in 2% Triton X-100 containing protease inhibitors (Roche). A BCA assay (Pierce ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The supernatant was applied to 2 mL of cOmplete Ni2+-agarose (Roche) prewashed with Buffer B (20 mM NaPi ...
-
bioRxiv - Neuroscience 2023Quote: ... The bill-skin was treated with 2 mg/mL collagenase P (Roche) in Krebs solution for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After incubation for 1-2 hours in a 1% blocking solution (Roche) dissolved in 1× PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM BME and one tablet of EDTA-free protease inhibitors (Roche)) ...
-
bioRxiv - Systems Biology 2023Quote: ... a total of 121 μL of 2× Kapa HiFi HotStart ReadyMix (Roche), 9.68 μL of PCR_PF (10 μM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 2% cOmplete EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland), 10 mM Na4P2O7 ...
-
bioRxiv - Biochemistry 2024Quote: ... the 2 ml Ni-NTA resin (cOmplete His-tag purification resin, Roche) was washed with 10 column volume (CV ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μg/ml pepstatin and 100 µg/mL protease inhibitor cocktail (Roche). The lysate was clarified by ultracentrifugation using a TLA-55 rotor (Beckman Coulter ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mM L-glutamine (all from Gibco)] supplemented with recombinant human IL-2 (50 U/mL; Roche, cat. 10799068001).
-
bioRxiv - Pathology 2024Quote: ... 2 % (v/v) FBS and DNase I (40 μg/ml, 10104159001, Roche) in PBS using the gentleMACS Octo Dissociator (Miltenyi Biotec) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT) supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche) and 1% Triton X100 ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM Tris(2-carboxyethyl)phosphine (TCEP) and complete protease inhibitor (Roche)) and added to the oligo-bound magnetic beads for 2 hours at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2 mM EGTA containing 80 uM of cold ATP (10519979001, Roche) was added to each reaction tube ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM MgCl and one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were sonicated in a water bath sonicator at 4°C for 6 minutes to generate a crude lysate ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM EDTA pH 8.0) supplemented with 1x protease inhibitor cocktail (Roche), and incubated for 30 min on ice ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4×PIC (Roche; Cat#05056489001)) was added to the pellets ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 mM ATP (Roche, 10519979001)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Version 4 (Roche, Mannheim, Germany), using MagNa Lyser Green Beads (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... A 2-step qPCR was done using the LightCycler 480 (Roche, Anderlecht, Belgium). The activation cycle was at 95 °C for 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... and 10 μl of 2× KAPA HiFi HotStart Ready Mix (KAPA Biosystems, USA). The following conditions were used ...
-
bioRxiv - Genomics 2021Quote: ... ChIP enrichments were confirmed by qPCR with 2× SYBR FAST mastermix (KAPA Biosystems) using the CFX384 Real-Time System C1000 Touch Thermo Cycler (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM TCEP and an EDTA-free protease inhibitor cocktail tablet (cOmplete, Roche)) and lysed by sonication ...
-
bioRxiv - Immunology 2021Quote: ... and 2 μl of 10 mg/ml of DNase (Roche, catalog no. 10104159001) in an Eppendorf tube ...
-
bioRxiv - Neuroscience 2020Quote: ... Pellet was enzymatically digested in collagenase/liberase TL (2 U/mL) (Roche Diagnostics) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR reaction was performed on a Light Cycler 2 (Roche) using 10 μL SYBR Premix Ex Taq (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol) and supplemented with complete EDTA-free cocktail tablets (Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 0.1 mM TCEP (Tris(2-carboxyethyl)phosphine) supplemented with cOmplete protease inhibitors (Roche). Clarified lysates were passed over 5 ml of packed Ni-NTA agarose resin (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1% 2-Mercaptoethanol) with freshly added protease inhibitor and phosphatase inhibitor cocktail (Roche). Protein equivalent to 10μg was estimated by Bradford assay.
-
bioRxiv - Neuroscience 2022Quote: ... followed by a 2 h incubation with Protein A Agarose beads (Roche, 11719408001) at 4 °C ...