Labshake search
Citations for Roche :
701 - 750 of 2285 citations for 6 Fluoro 2 methylindole 3 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were plated onto collagen-coated plates and transfected at 60-80% confluency using FuGENE 6 (Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Microbiology 2020Quote: Adherent macrophages in 6-well plates were washed with PBS containing 1 mM sodium orthovanadate and 10 mM 1,10-phenanthroline (Roche) on ice prior to lysis ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... the dorsal skin of C57BL/6 neonates was collected and incubated overnight with 1 mg/mL collagenase/dispase (Roche). The dermis and epidermis were separated by incubating the skin with 0.25% trypsin/10 mM EDTA in phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Microbiology 2021Quote: Virus stocks were generated by transfection of 293T cells with each plasmid clone of HSIV-vif using Fugene 6 or X-tremeGENE 9 DNA transfection reagent according to the manufacturer’s protocol (Roche). Infectious titers were determined by limiting dilution infection analysis using TZM-bl indicator cells and the amount of virus in supernatants was measured by HIV-1 p24gag antigen ELISA (Advanced Bioscience Laboratories).
-
bioRxiv - Physiology 2021Quote: ... Reactions were performed in a 6 μl volume of 1 x Kapa Probe Fast Mastermix (Kapa Biosystems, Amsterdam, Netherlands). TaqMan assays (FAM labelled ...
-
bioRxiv - Immunology 2019Quote: ... 4μg of Env DNA containing CMV promoter was combined with 4μg of SG3Δenv backbone and FuGene 6 transfection reagent (Roche Diagnostics) was added as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 400ng of total RNA (RIN >6) was used to generate polyA-selected libraries with Kapa mRNA HyperPrep kits (Roche) with indexed adaptors ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.6; 15 mM NaCl; 10% glycerol; 0.5% Tween 20; 10 mM imidazole; 1 mM DTT; 20 mM NaHCO3; Roche protease inhibitors cocktail without EDTA) ...
-
bioRxiv - Microbiology 2023Quote: 10-25ml of bacterial cultures were pelleted and resuspended in extraction buffer (50mM Tris-HCl pH 7.5, 5mM EDTA, and 6% SDS) with protease inhibitor cocktail (Roche; 1mg/ml Aprotinin ...
-
bioRxiv - Systems Biology 2023Quote: Glucose concentrations from the chemostat samples were determined enzymatically with a solution of hexokinase/glucose-6-phosphate dehydrogenase (Roche) in Pipes buffer at pH 7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 μg pAcBAC3 plasmid was used to transfect RAW 264.7 cells by mixing the DNA with 6 μg X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μL of 180 mM of adenosine triphosphate (ATP) and 0.5 U of Glucose-6-phosphate dehydrogenase(G6PDH) (Roche). After the absorbance at 340 nm was recorded for 20 min to determine a baseline ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was stored as flow through and the beads were washed 6 times with 1 ml RIPA buffer complemented with 0.25× protease inhibitor (cOmplete, Roche). Bound proteins were eluted from agarose beads with 1 bead volume of Laemmli buffer heated at 95°C for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... αSMA-tk;RFP mice and C57BL/6 mice received intraperitoneal (i.p.) injections with 12.5 mg/kg of body weight of ganciclovir (GCV, Cymevene®, Roche) every 48h ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.7 µM of total delta-Phe aa-tRNA (total tRNA charged with all amino-acids except Phe; tRNA from Roche) and 100 nM of EF-G were used ...
-
bioRxiv - Immunology 2019Quote: ... Samples were washed in 1X maleic acid buffer with 0.1% Tween-20 (MBST) and then incubated in Roche Blocking Reagent (Roche, 1096176) with 10% heat inactivated sheep serum (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Viral transport media was added to each pool at a 1:1 ratio for nucleic acid extraction performed on the Roche MagNA Pure 24 platform using the MagNA Pure 24 Total NA Isolation kit (Roche). Elution volume was set to 50 ul to concentrate viral RNA ...