Labshake search
Citations for Roche :
701 - 750 of 8226 citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized by adding 4 units of AMV reverse transcriptase enzyme (Roche) and 0.5 μl 20 pmol/μl of reverse primer labeled with [32P] per reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... 1ml of digestion solution (TM Liberase at 4 units/mL (Roche, Basel, Switzerland) and DNAse Type I at 800 units/mL (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR mastermixes were prepared with 4 μl Light Cycler Enzyme Mix (Roche, Germany), 0.6 μl 10 μM primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 μl/ml of a 4% stock solution of blocking reagent (Roche 11096176001) which was dissolved and autoclaved in MNT solution (150 mM maleic acid pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM Sodium Orthovanadate and supplemented with protease inhibitors (Complete protease inhibitors, Roche). After a 20min incubation on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs were incubated for 4 h with 10 ng/ml colcemid (Roche, 10295892001). Cells were then collected and incubated for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM EDTA) supplemented with cOmplete Mini EDTA-free protease inhibitor cocktail (Roche). Proteins were resolved on a 4%–12% bis-tris gel (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 4 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then stained overnight at 4°C with pre-absorbed AP-conjugated sheep anti-DIG antibody (1:1000, Roche, cat. 11093274910) in PBS containing 0.1% Triton X-100 and 20% horse serum ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated alone or with ipICP4/pICP4 or BSA for 1 h at 4°C and subsequently fluorescence intensity was measured in a LightCycler II (Roche, Milan, Italy) by observing 6-carboxyfluorescein (6-FAM ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were separated by SDS-PAGE on 4-12% Bis-TRIS SDS-polyacrylamide gels (Novex, NP0322BOX) and analysis was done against primary antibodies α-HA (1:1000, Roche, 12CA5) or α-Tub2 (1:4500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Cell Biology 2024Quote: ... the full-length Treacle was amplified by PCR from cDNA with primer set #4 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BglII and BamHI sites respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... mitochondria were resuspended in 1 ml solution B containing protease inhibitor (PI; Roche) and incubated with anti-TOM22 microbeads on a rotary wheel for 30 mins at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested rotating for 1h at 37°C with 2mg/ml Collagenase/Dispase (Roche) and then filtered twice (100 μm ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the DNA template was degraded by 1h incubation with 0.2U/µL DNaseI (Roche). Transcription products were loaded on a 1 mL G-25 Superfine Sephadex column (Cytiva ...
-
bioRxiv - Immunology 2022Quote: ... These tissues were cut to ∼2mm pieces and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in MABTr and then incubated in NBT (nitro blue tetrazolium)/BCIP (bromo-chloro-indolyl-phosphate, Roche) for colour development ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei pellets were resuspended in 100 µl of nuclei lysis buffer (20 mM HEPES pH 7.9, 0.1 M NaCl, 1mM EDTA, 1 mM EGTA, 1mM DTT, 25 % glycerol, 0.5 mM AEBSF, 1×Roche complete protease inhibitor cocktail) for 20 min at 4 °C with rotation ...
-
bioRxiv - Immunology 2020Quote: ... patients with at least one nasopharyngeal swab positive for SARS-CoV-2 as determined by qRT-PCR (Roche LightCycler480 ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal (3F10) antibody directed against the HA epitope and monoclonal (B-2) antibody against GFP were purchased from Roche and Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Developmental Biology 2019Quote: ... All three vectors were transfected into DLD-1 TIR1 cells using Xtreme Gene 9 DNA transfection reagent (Roche). Cells were sorted based on their YFP fluorescence and single clones were isolated ...
-
bioRxiv - Biochemistry 2023Quote: ... pCW57.1_yeastAOX 32 with the Delta-Vpr packaging plasmids and the VSV-G envelope plasmid (DNA concentration ratio, 1.2: 1: 0.3) into HEK293T cells using X-tremeGENE 9 Transfection Reagent (Roche). Lentivirus-containing media was harvested at 24 hr after fresh media change ...
-
bioRxiv - Cell Biology 2020Quote: ... X-tremeGENE 9 and Complete Protease Cocktail from Roche; Alexa 488 ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids were transfected using either X-tremeGENE 9 (Roche), polyethylenimine (Polysciences ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were cotransfected using XtremeGENE 9™ (Roche) using the above CRISPR plasmid ...
-
bioRxiv - Developmental Biology 2020Quote: ... The transfection reagent XtremeGENE 9 was purchased from Roche Molecular Systems and polybrene from MilliporeSigma ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and GFP- tagged pCREB3L3 using X-tremeGENE 9 (Roche). Cells were grown on coverslips ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... Indicated plasmids were transfected with X-tremeGENE 9 (Roche) according to the manufacturer’s instructions ...