Labshake search
Citations for Roche :
7051 - 7100 of 8748 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Prehybridization for 60 min and overnight hybridization were carried out with a DIG-labeled probe (1 µg) at 65 °C with DIG Easy Hyb Granules (Roche). A chemiluminescent assay was used to visualize the probe on the membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were re-suspended in 500 µL of lysis buffer (PBS containing 1 % Triton-X 100 and complete protease inhibitors [Roche]). DAPI was added to lysis buffer (final concentration 5 µM ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed twice with PBS and lysed using a lysis buffer (50mM Tris, pH7.4; 150mM NaCl; 1% NP-40) supplemented with protease (Roche, #11836153001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of the reverse transcrip-tion mix from the Titan One Tube RT-PCR System kit (Roche, Switzerland) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... then lysed on ice for 15 minutes in non-denaturing lysis buffer (150 mM KCl, 10 mM MgCl2, 5mM HEPES, 1% IGEPAL) supplemented with protease inhibitors (Roche Complete EDTA-free ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and lysed in 50 μL of lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 1% Triton-X-100, 1x cOmplete EDTA-free protease inhibitor cocktail [Roche]) at 4 °C for 15 min ...
-
bioRxiv - Immunology 2024Quote: ... 1 μg of total RNA was reverse transcribed using the Roche Transcriptor First Strand cDNA synthesis kit (Roche Life Sciences) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... antibody in-situ stainings were done as described previously (Haussmann et al., 2008) for validation using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-GFP (Molecular Probes ...
-
bioRxiv - Cell Biology 2024Quote: ... dissected TA muscles were first digested with 10ml muscle digestion buffer (DMEM containing 1% penicillin/streptomycin, 0.125mg/ml Dispase II (Roche, 04942078001), and 10mg/ml Collagenase D (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and lung lobes were finely minced and incubated in 15 mL of complete media containing 1 mg/mL collagenase (Roche) and 17 U/mL DNase I (Sigma Aldrich ...
-
bioRxiv - Genetics 2024Quote: The entire ∼8kb NR2E3 locus was amplified using NR2E3 F and NR2E3 R primers (Table 1) with the Expand Long Template PCR System (Roche) buffer system 1 ...
-
bioRxiv - Biophysics 2024Quote: ... 2.0 × 106 cells/mL of WT Neuro2a or OptoTau KI cells were incubated in 10 mM of HEPES buffer supplemented with 1% protease inhibitor (cOmplete, Roche), 1 µM of okadaic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2024Quote: ... the tissue samples were dissected into smaller sections with sterile scalpels and incubated in 100 μl of PBS and 50 μl of Liberase TL (1 mg/ml; Roche) for one hour at +37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... desoxycholic acid-Na-salt 1%, SDS 0.1%) (Serva electrophoresis, Germany) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (Roche, Switzerland). Western blots were performed following routine protocols67 ...
-
bioRxiv - Molecular Biology 2024Quote: ... of RIPA buffer (150 mM NaCl, 50 mM Tris pH 8.0, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS and Roche complete protease inhibitors) using a Teflon homogenizer ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with a 20-fold excess of unlabeled oligonucleotide with the same sequence as the labeled one (to prevent reannealing) and 1 µl of Proteinase K (18 mg/ml) (Roche). After deproteination for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: Xenograft OS tumors were harvested and microdissected 12 d after 143B OS cell inoculation and digested with collagenase type I and II (1 mg/ml; Roche) digestion for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were blocked and then incubated with 1/4000 concentration of anti-DIG Fab fragment conjugated with alkaline phosphatase (Roche) overnight at 4ºC ...
-
bioRxiv - Neuroscience 2024Quote: ... The mixture for qPCR reaction was prepared in a final volume of 20 μl containing 1 μl cDNAs and 10 μl of LightCycler 480 SYBR Green I Master (Roche) in the presence of primers at 500 nM ...
-
bioRxiv - Plant Biology 2024Quote: Seed histological sections were washed with Phosphate Buffered Saline solution (PBS) and digested with 1 mg/ml proteinase-K (Hoffmann-La Roche). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were washed 3x 15 minutes in room temperature TBST (Tris-buffered saline with 1% Tween 20) and blocked at room temperature for one hour in 10% DIG buffer (Roche) in TBST.
-
bioRxiv - Immunology 2024Quote: ... Quantitative RT-PCR analysis was performed with selective primers (Supplementary Table 1) using the Light Cycler 480 SYBR Green I Master X2 Kit (Roche), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Probed membranes were washed and incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit Abs for 1 hour and developed with Lumi-LightPLUS Western Blotting Substrate (Roche). Quantification was performed on Lumi-Light autoradiography films using ImageJ software.
-
bioRxiv - Cancer Biology 2024Quote: ... Total proteins from T-ALL#1 cells were extracted with a RIPA buffer containing a cocktail of 1Xprotease inhibitors (11836145001, Roche) and 1X phosphatase inhibitors (P2850 ...
-
bioRxiv - Immunology 2024Quote: ... whole pituitaries or separate posterior and anterior pituitaries were mechanically lysed by suspending and digested with 50 µg/ml DNase 1 (Roche) and 1 mg/ml Collagenase D (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... life-Tein LLC) was mixed with 50µl of PBS containing 1% Tween20 and 5ng/mL anti-HA-Peroxidase 3F10 antibody (Roche #12013819001) and transferred to the wells ...
-
bioRxiv - Bioengineering 2024Quote: ... or 1 M NaCl (for ori designs), 20 µg/mL DNase (#A3778, ITW Reagents) and protease inhibitor cocktail (04693132001, Roche)) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cells were lysed in NP40 cell lysis buffer (10mM Tris-Cl, pH 7.4, 1% NP40, 1X Roche Complete protease inhibitors) at 4C for 1 hour followed by centrifugation at 18,000 g for 10 mins and supernatant collected as sample for analysis ...
-
bioRxiv - Genomics 2024Quote: ... Indexing PCR was performed to add Nextera index adapters (1 μM final, Integrated DNA Technology) using KAPA HiFi reagents (#KK2102, Roche). Libraries were pooled in equal volumes and a final 0.8x cleanup was performed with homebrew SeraMag beads before measuring the sample concentration and sizing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Immunology 2021Quote: ... The pancreas was inflated via the common bile duct by adding ∼3 ml of 0.8mg/ml Collagenase P (Roche) and 10µg/ml Dnase I (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μg each lysate was pre-cleared with 20 μl of Protein A agarose beads (3 mg/ml, Roche) in 200 μl for 1 hour at 4°C on a Labquake Rotator (Barnstead Thermolyne) ...
-
bioRxiv - Cell Biology 2022Quote: ... The pellet was resuspended with 3 ml S1 solution (0.25 M sucrose, 10 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) by pipetting up and down ...
-
bioRxiv - Physiology 2022Quote: ... for 3 min and incubated twice for 3 min with CSK buffer containing 0.5% Triton X-100 and complete protease inhibitors cocktail (catalog no. 11873580001, Roche). Cells were after washed with PBS-S ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Immunology 2020Quote: Mice were euthanized and lungs were gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...