Labshake search
Citations for Roche :
651 - 700 of 1129 citations for L Leucine 3 4 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM KAc, 1 mM MgCl2, 1 mM EGTA, 1 mM DTT, 0.1 mM ATP, 20 mM PMSF, and 10 Roche protease inhibitor tablets per L) and lysed by a dounce homogenizer ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were fixed with 4%PFA and 100 μl of Annexin-V-Alexa 568 labeling solution (Roche) and 50 μM Sytox Green dye (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were incubated overnight at 4°C with a 1:2000 dilution of anti-digoxigenin antibody (Roche) in blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 15 minutes with 4 μL of X-treme Gene HP DNA transfection reagent (Roche). Transfected cells were selected for by hygromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...
-
bioRxiv - Microbiology 2021Quote: ... 16S variable region 4 (V4) amplifications were carried out using the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems) and barcoded primers 515F and 806R50 ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were probed overnight at 4 °C with anti-GFP primary antibodies (Roche 11814460001; 1:1000) and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson Immunoresearch # 115-035-146 ...
-
bioRxiv - Biophysics 2021Quote: ... liposomes (final lipid concentration = 1 mM) were blocked with 4% (w/v) fatty-acid-free BSA (Roche) in HK buffer for one hour at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... Then samples were incubated overnight at 4°C with the following antibodies: anti-HA clone 3F10 (Roche) or anti-M57 clone M57.02 (Center for Proteomics ...
-
bioRxiv - Pathology 2021Quote: ... Then hearts were perfused and digested with perfusion buffer plus 0.067 mg/ml Liberase Blendzyme 4 (Roche) for 30min ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated overnight at 4°C with 1:4000 alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) in buffer 2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellet was washed 4 times in PBS containing cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Protein samples were mixed with 4X LDS buffer containing DTT (NuPAGE™ Thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µg of genomic DNA in total was amplified by using Kapa HiFi HotStart ReadyMix (Roche KK2602). For external PCR step ...
-
bioRxiv - Neuroscience 2022Quote: ... Following an overnight incubation at 4 °C with rat anti-HA (1:500, monoclonal, Roche, Cat # 11867423001) or mouse anti-GAPDH (1:25.000 ...
-
bioRxiv - Immunology 2022Quote: ... was incubated for 30m at 4 °C and detection was achieved using UltraView DAB detection kit (Roche). Protein expression was scored by a board-certified pulmonary pathologist blinded to cohort status or treatment group ...
-
bioRxiv - Microbiology 2023Quote: ... The IVT reactions were incubated at 37 °C for 4 h and digested with DNase I (Roche). RNA was purified by denaturing PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Pathology 2023Quote: ... After addition of 4% sodium phosphotungstic acid in 170 mM MgCl2 and protease inhibitors (Complete-TM, Roche), extracts were incubated at 37 °C for 30 minutes and centrifuged at 18,000 x g for 30 minutes at 25 °C ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The samples were then incubated overnight at 4°C with anti-fluorescein-POD (1:2000, Roche, #11426346910).
-
bioRxiv - Cancer Biology 2023Quote: ... + 4% fetal bovine serum (FBS, Hyclone) and 0.01 mg/mL insulin-transferrin-sodium-selenite solution (ITSS; Roche) as previously described 28,29 ...
-
bioRxiv - Microbiology 2023Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) the lysate was transferred to 50 μl HA bead slurry (anti-HA affinity matrix, Roche) or 30 μl c-myc bead slurry (EZview red anti-c-myc affinity gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... IHC single- and multiplex-staining were performed on 4 µm sections using the Discovery ULTRA stainer (Roche). Antibodies and dilutions are provided in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...