Labshake search
Citations for Roche :
651 - 700 of 1283 citations for 7 methylsulfanyl 4 oxo 1H quinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Cell Biology 2019Quote: ... Tissues were incubated with secondary antibodies plus DAPI (4’,6-diamidino-2-phenylindole; Roche) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µL egg extract was diluted in 16.5 µL reaction buffer (80 mM β-glycerophosphate, 20 mM EGTA, 15 mM MgCl2, 10 uM okadaic acid, 1x protease inhibitor (Roche, cOmplete #11873580001), 100 µM ATP ...
-
bioRxiv - Genomics 2023Quote: DNA was purified from 200μL Aptima tube specimens using the MagNA Pure Total Nucleic Acid Isolation Kit I (Roche Applied Science, Indianapolis, IN) external lysis protocol on the automated MagNA Pure 24 Instrument and 50µL elution ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Microbiology 2019Quote: ... were transfected with 20 ng pNF-□B-Luc and 3 ng pRL-TK using FuGENE 6 (Roche). Transfected cells were incubated for 24 h (37°C ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...