Labshake search
Citations for Roche :
651 - 700 of 7678 citations for 7 AMINO 2 TERT BUTOXYCARBONYL 1 2 3 4 TETRAHYDROISOQUINOLINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... BSA fraction V (2% wt/vol) (Roche Diagnostics), 2-mercaptoethanol (50 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg/ml lysozyme and protease inhibitors (Roche) per 1 L of culture ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% sodium dodecyl buffer (SDS)] containing protease (Roche) and phosphatase (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% SDS and a cocktail protease inhibitor (Roche)] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5mM EDTA and 2% Protease inhibitor (Roche, Complete) boiled for 10 min at 70°C in SDS loading buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.01% digitonin + 2 U/mL RNase inhibitor (Roche). Epicardial preparations (2 biological replicates at 10PWC ...
-
bioRxiv - Microbiology 2023Quote: ... and 2) a KAPA HiFi PCR kit (Roche) was used to perform the amplification in place of the reagents included in the Nextera XT kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 tablets complete EDTA-free protease inhibitor (Roche)) followed by 5 min incubation at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μl of micrococcal nuclease (Nuclease S7, Roche) was added and the lysates were incubated at 25 °C for 18 min using a thermal cycler (Techne-Prime ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL 20 mg/mL Glycogen (Roche, 10901393001)) at 37°C for 2 hr and subsequently subjected to Proteinase K (15 μL 10% SDS ...
-
Identification of plants functional counterparts of the metazoan Mediator of DNA Damage Checkpoint 1bioRxiv - Cell Biology 2023Quote: ... 2 µl/ml Benzonase) containing protease inhibitors (Roche) and sonicated for 2 min (5’’on/5’’off ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM DTT with Protease inhibitor cocktail (Roche) and incubated for 10 min on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM EDTA complemented with phosphatase ihibitor (Roche Diagnostics Scandinavia AB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2 mg/ml collagenase/dispase (Roche, 10269638) at 37°C for 40 min with gentle agitation ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mg/ml collagenase A (#1013586001, Roche, Switzerland), 0.2 mM CaCl2 (#C5670 ...
-
Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss With Childhood OnsetbioRxiv - Neuroscience 2023Quote: ... Terminal transferase (2 µl/ml; Roche, Basel, Switzerland) and biotinylated dUTP (1 µl/ml ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Biophysics 2020Quote: ... the same procedure was used using different lysis (50 mM HEPES pH 7.4, 100 mM NaCl, 10% glycerol, 1 mM DTT, 1 mM ATP, 2 mM PMSF, 1 Roche tablet per 50 mL) and storage (50 mM Tris pH 7.4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM MgCl2; 2 mM EGTA pH 8.0; 0.1% Triton X-100; 0.1 mM PMSF; 1x Roche Complete protease inhibitors cocktail) supplemented with increasing NaCl concentrations (80-600 mM ...
-
bioRxiv - Cancer Biology 2022Quote: NGS libraries were prepared from extracted gDNAs following a 2-step PCR protocol with 2 x KAPA Mastermix (KK2612, KAPA Biosystems). For spleen Tregs and CD4s ...
-
bioRxiv - Cancer Biology 2024Quote: ... The aqueous phase from each MaXtract tube (∼400 µl) was then transferred to 1.5 ml tubes containing 2 µl of 2 µg/µl glycogen (Roche, Cat# 10901393001), 1 ml ethanol was added ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl of 1:10 diluted DNA or cDNA and the SYBR Green I Master mix (Roche). We used PCR conditions adapted from Henneberger et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 M NaCl 1 mM TCEP) supplemented by one protease inhibitor cocktail tablet Complete EDTA-free (Roche) and centrifuged for 30 min at 18,000 g 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2021Quote: ... which was suspended into 1 ml cold Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and 5 μl Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: A subcutaneous dose (1 or 2 mg/kg of weight) of diazepam (DZPM, Valium ®, Roche; México) or saline solution (SAL ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with 1 ml lysis buffer (0.5 % Nonident-P40, 2 % protease inhibitor cocktail (Roche, Switzerland) and 1 % phosphatase inhibitor cocktails I and II (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... were lysed in 100 µL or 300 mL RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% IGEPAL CA-630, 0.25% Na-deoxycholate, 2 mM EDTA, 0.1% SDS, Roche cOmplete™ Mini protease Inhibitor Cocktail) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM tris(2-carboxyethyl)phosphine (TCEP) and protease inhibitor (cOmplete EDTA-free Protease Inhibitor Cocktail, Roche)) ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.15% NP40, 1 x Complete protease inhibitors, Roche) and rotated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with the primers listed in the section above ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...