Labshake search
Citations for Roche :
6701 - 6750 of 7422 citations for 6 Bromo 2 trifluoromethylimidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... treatments to remove the first antibody (42) followed by overnight incubation of pooled samples with anti-FLU antibody conjugated to alkaline phosphatase (1:2000, Roche). Expression of myl7 in 28 and 55 hpf embryos was then revealed by Fast Red (Sigma ...
-
bioRxiv - Microbiology 2019Quote: Immunoprecipitation was performed using IP buffer (1% Nonidet P-40, 50mM Tris-HCl [pH 7.5], 150mM NaCl, and Complete™ protease inhibitor cocktail-EDTA (Roche)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM NaF and 1 mM Na3VO4) in the presence of complete EDTA-free protease inhibitor cocktail (Roche Life Science) for 20 min at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... Sections were then dried and covered in an alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:3000; Roche, Mannheim, Germany) in buffer B1/2.5% goat serum at 4°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: Round spermatids enriched by STA-PUT were lysed with 1% Triton X-100 in PBS supplemented with EDTA-free protease inhibitor cocktail (Roche) by gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein aggregation was evaluated by western blot in total cell extracts prepared in 1% Triton X-100 in PBS containing proteases and phosphatases inhibitors (Roche). Sample quantification was performed with the Pierce BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... and 5% glycerol with the addition of 1 EDTA-free cOmplete protease inhibitor cocktail tablet per 50 mL lysate (Roche). Cells were lysed by sonication on ice with stirring and the lysates were clarified by centrifugation at 20,000 g for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: Harvested cells were resuspended in lysis buffer (50mM Tris-Cl pH 7.5, 150mM NaCl, 1mM MgCl2, 1% NP40) supplemented with protease inhibitor (Roche 11836170001) and phosphatase inhibitor cocktail (Sigma P5726 ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were washed with cold 1x PBS three times and before scrapping the samples in cold lysis buffer (50 mM Tris pH 7.6, 200 mM NaCl, 1% Triton X-100, 0.5% CHAPS + complete protease inhibitor/Roche Cat# 11836153001). The samples were mechanically disrupted by passing them through a 27.5 syringe five times before sonication on ice (1 sec on ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue was homogenized by probe sonication at 20kHz for 10s in ice-cold TBS buffer (tris-buffered saline, 1% Triton X-100; pH 7.4) containing protease inhibitor (Roche 11697498001) and phosphatase inhibitor (Sigma 4906845001 ...
-
bioRxiv - Neuroscience 2021Quote: ... Both NIB and IP Buffer were supplemented with an EDTA-free cOmplete protease inhibitor cocktail tablet (1 tablet/28 ml; 11873580001, Roche) and RNasin Plus RNase inhibitor (0.2% ...
-
bioRxiv - Genetics 2021Quote: Animals were resuspended in lysis buffer (50 mM Tris/HCl pH 7.4, 100 mM NaCl, 1% v/v SDS, complete protease inhibitor cocktail (Roche Diagnostics)) ...
-
bioRxiv - Immunology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.1% SDS and 1%Triton X-100 and protease inhibitors cocktail (Mini-Complete EDTA-free; Roche Applied Science, Penzberg, Germany). Lysates were centrifuged (13000g ...
-
bioRxiv - Neuroscience 2021Quote: Dissected brain regions of interest or culture samples were homogenized with TX-soluble buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 1% Triton-X 100) containing protease and phosphatase inhibitors (Roche, USA). The supernatants were collected for soluble fraction after centrifugation (20 ...
-
bioRxiv - Biochemistry 2021Quote: Cells confluent in a 15-cm dish were washed by PBS buffer three times before being lysed on plate with 1 mL ice-cold NP-40 lysis buffer supplemented with protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mM EDTA at pH 8, 10% glycerol, 1 mM DTT, 0.5 mM PMSF, 0.1 mM sodium orthovanadate, and 1X Roche protease inhibitors). Collected nuclear pellets were lysed in in 1× RIPA buffer (10 mM Tris-Cl at pH 8.0 ...
-
bioRxiv - Cancer Biology 2020Quote: ... minced with a sterile scalpel in a petri-dish containing complete medium (DMEM/10%FBS/2mM L-Glutamine/1x NEAA/1x Sodium Bicarbonate/10mM HEPES/ 1x Pen/Strep) and then incubated with complete medium containing 1 mg/ml Collagenase P (Roche) for 90 minutes at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was carried out in 8 μl with a primer concentration of 1 μM and SYBR Green Master mix (Roche) in a Roche LightCycler 480 system ...
-
bioRxiv - Cell Biology 2019Quote: Protein lysates from whole pancreas were prepared in 1 mL of RIPA buffer supplemented with phosSTOP phosphatase and protease inhibitors (Roche). Protein concentrations were measured using the BCA kit (Thermo Scientific ...
-
bioRxiv - Genomics 2019Quote: ... Five to six samples at a time were then multiplexed and underwent enrichment for a 43-gene targeted RNA fusion panel (Table 1) using Roche SeqCap RNA Choice target enrichment probes spanning the entirety of the gene transcripts of interest (Roche Sequencing ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% Blocking reagent + 20% Goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Roche) in the blocking buffer ...
-
bioRxiv - Immunology 2020Quote: ... Bacterial pellets obtained by centrifugation at 13,500g for 10 min at 4°C were resuspended in 1 ml of PBS containing protease inhibitors (cOmplete Mini, Roche; 1 tablet per 10 ml of PBS following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... digested using 0.1 % papain at 37°C for 10 min and for 5 additional minutes in presence of DNAse1 (1 mg/ml, Roche). After stopping papain activity by adding MC+ media ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed using the same lysis buffer as used for the ribosome profiling experiment with 1× protease inhibitor cocktail (Roche), omitting cycloheximide ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... mouse thymus was collected and homogenized in 1 ml of cold PBS containing cOmplete protease inhibitor cocktail (Roche, Indianapolis, IN) using a tissue homogenizer (Omni International ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein extracted using RIPA buffer with protease inhibitor cocktail mix (1 Complete MINI EDTA-free protease inhibitor tablet (Roche), 25 μg/mL calpain inhibitor (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50 mM NaCl, 50 mM sodium pyrophosphate, 50 mM sodium fluoride, 1% Triton-X-100, 10% glycerol, 5 mM EDTA, Roche MiniProtease Inhibitor cocktail tablet ...
-
bioRxiv - Neuroscience 2022Quote: ... and proteins were transferred to an activated (100% ethanol, 1 min; followed by two washing steps with water) PVDF membrane (Roche Diagnostics GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM TCEP 10 % v/v glycerol) supplemented with 4x EDTA-free protease inhibitor cocktail tablets (Roche, cat. No. 11836153001) and 4 μg/ml DNase I ...
-
bioRxiv - Developmental Biology 2022Quote: ... before being incubated in TNTw/block for 1 hour followed by an ON incubation with anti-DIG or anti-Fluo horseradish peroxidase (Roche). Post-antibody washes and the TSA reactions were repeated as for the first probe ...
-
bioRxiv - Cell Biology 2022Quote: ... Thawed pellets were resuspended with 200-300 µL native lysate buffer (1% NP-40 with 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche] ...
-
bioRxiv - Cell Biology 2022Quote: ... At the completion of the assay islets were lysed in RIPA buffer (Pierce) containing 1 mM PMSF and EDTA-free protease inhibitor cocktail (Roche)) at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Protein lysates were collected from worms using RIPA buffer (50 mM Tris-HCl, 250 mM sucrose, 1 mM EDTA, and Roche protease inhibitor tablet ...
-
bioRxiv - Biophysics 2022Quote: ... cells were gently washed twice with 500 μl cold PBS and directly lysed in 50 μl of lysis buffer (PBS, 1% (v/v) Triton X-100 and protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 1:500 for 32 min was used followed with the secondary antibody OmniMap anti-rabbit HRP (760-4311, Roche). Antigen-antibody complexes were revealed with ChromoMap DAB Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 ng of U1 RNA (TMG or NAD cap) and 150 ng of HIV-1 mRNA were mixed with ResoLight dye (1x, Roche) and annealing buffer (10 mM Tris ...