Labshake search
Citations for Roche :
601 - 650 of 3284 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 2% paraformaldehyde/ 2% sucrose for 20 min and stained with DAPI (#10236276001, Roche) to visualize anaphases ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Genetics 2020Quote: ... using 5 µL 2x KAPA mix (Roche, #KK2602), 10 µL cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 µg of RNase A (Roche Diagnostics) were added per µg of sample ...
-
bioRxiv - Physiology 2021Quote: ... midazolam (5 μg/g; Roche, Grenzach-Wyhlen, Germany) and fentanyl (0.05 μg/g ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μl phosphatase inhibitor 10X (Roche, 04906837001). Protein extracts from MCF10A-ER-Src were obtained by incubating cell pellets in Lysis Buffer SDS-Free containing 1% protease inhibitors and 1% phosphatase inhibitors on ice for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM DTT and proteinase inhibitor cocktail (Roche)) at 2ml/g ...
-
bioRxiv - Microbiology 2020Quote: ... 5% glycerol) containing protease inhibitors (Roche, Basel, Switzerland). Total cell lysates (25 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... 10mM NaF) and complete protease inhibitors (5×; Roche). The detergent soluble supernatant fractions were immediately processed for SDS– PAGE and immunoblotting with antibodies.
-
bioRxiv - Plant Biology 2021Quote: ... 5 μl SYBR Green PCR master mix (Roche) and ultrapure water up to 10 μl was used and analyzed using the LightCycler 480 System (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl of PCR DIG labelling mix (Roche), 3 μl template DNA ...
-
bioRxiv - Genetics 2020Quote: ... 5 mM EDTA with protease inhibitor cocktail (Roche), incubated at 4 °C for 30 min followed by centrifugation at 14000 rpm for 30 min to collect the supernatant ...
-
bioRxiv - Immunology 2022Quote: ... including 5% Western Blocking Reagent Solution (#11921673001, Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA with protease inhibitors (11697498001, Roche)) by sonication using TAITEC VP-5S sonicator (output ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... 5 mM EDTA] containing protease inhibitor (Roche, 11836153001) and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2022Quote: ... in 5% blocking solution (Roche, cat. no.11096176001) at room temperature overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... midazolam (5 mg/kg body weight; Dormicum, Roche) and medetomidine (0.5 mg/kg body weight ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL DNAse and protease inhibitors (Roche) and lysed by sonication ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL DNAse and protease inhibitors (Roche). Lysate was incubated with 1% N-Dodecyl-β-D-maltoside for 1 hour at 4°C with mixing and then spun down at 20,000g for 20 minutes at 4°C to remove cell debris ...
-
bioRxiv - Cell Biology 2024Quote: ... treated with 5 μg/mL Proteinase K (Roche) and post-fixed in 4% (vol/vol ...
-
bioRxiv - Developmental Biology 2024Quote: ... + 5% SDS + 2x cOmplete protease inhibitor cocktail (Roche). After centrifugation at 14k rpm for 10 min at RT ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM magnesium chloride and protease inhibitors (Roche). A FastPrep-24 (MP Bio ...
-
bioRxiv - Genetics 2023Quote: ... and 5 µL 2x KAPA HiFi ReadyMix (Roche). The following indexing primers were used (X indicates the positions of the 8 bp indices):
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM DTT and 1x Protease inhibitor (Roche)) ...
-
bioRxiv - Genetics 2023Quote: ... 5 µL KAPA HiFi HotStart ReadyMix (KAPA Biosystems) and 1.8 µL H2O HyPure ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5 µg/mL DAPI (Cat# 10236276001, Roche).
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/mL deoxyribonuclease I (Roche 1010459001)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/ml dispase II (4942078001, Roche). Hydrogels were seeded at a concentration of 500 cells per 200 μL gel (2.5 cells/μL) ...
-
bioRxiv - Neuroscience 2023Quote: ... and laminin at 5 μg/ml (Roche # 11243217001). Cells were cultured in the presence of differentiation factors for 40 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked using 5% BSA (#3117332001, Roche) in TBS pH 8 buffer solution ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μg/mL PK (Roche, catalog number 03115852001) was added to the reactions and kept on ice for 10 min ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL 2X SYBR green master mix (Roche) and nuclease-free water added to a final volume of 10 μL per well ...
-
bioRxiv - Neuroscience 2024Quote: ... midazolam (5 mg/kg body weight; Dormicum, Roche), and medetomidine (0.5 mg/kg body weight ...