Labshake search
Citations for Roche :
601 - 650 of 10000+ citations for Mouse Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Resulting amplicons were used as templates for the synthesis of either digoxigenin (DIG) or fluorescein (FITC)-labelled anti-sense probes by in vitro transcription using T7 or T3 polymerases (Roche) and DIG or FITC RNA labelling mixes (Roche).
-
bioRxiv - Physiology 2024Quote: ... Gene expression was measured by quantitative reverse transcription PCR (qPCR) using LightCycler 480 SYBR Green I Master (50-720-3180 Roche). Quantitative polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal mouse anti-HA (MMS-101R; Covance) or monoclonal mouse anti-GFP antibodies (11–814–460-001; Roche) prior to secondary antibody treatment with polyclonal goat anti-mouse conjugated to horseradish peroxidase (115–035-146 ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lysate was incubated with agarose beads conjugated with either mouse IgG or mouse anti-GFP antibodies (Roche) for 3h at 4°c under gentle agitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GFP (7.1+13.1, Roche, 11814460001) and normal rabbit IgG (Millipore 12-370).
-
bioRxiv - Cell Biology 2019Quote: ... HRP-conjugated anti-mouse secondary antibody (Roche) and ECL (PIERCE ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-myc from mouse (9E10; 11667149001; Roche) and anti-HA from mouse (12CA5 ...
-
bioRxiv - Genetics 2021Quote: Mouse bi-clonal anti-GFP antibody (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2021Quote: ... primary mouse anti-DIG (Sigma Roche 11333062910) was added at the dilution of 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10µg anti-GFP mouse (Roche, Catalog #11814460001) and 1mL of NP-40 lysis buffer was added to the DYNAbeads tube ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-GFP monoclonal antibody (Roche, 11814460001) was covalently coupled to magnetic beads at 12 μg antibody per 100 μL Dynabeads Protein A (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-GFP mouse monoclonal antibody (Roche Diagnostics), anti-tubulin α mouse monoclonal antibody (Merck Chemicals GmbH) ...
-
bioRxiv - Plant Biology 2021Quote: ... mouse anti-GFP (Roche catalogue no 11814460001), 1:2500 ...
-
bioRxiv - Cell Biology 2019Quote: ... or mouse raised anti-GFP antibodies (Roche) for 2 hours ...
-
bioRxiv - Plant Biology 2019Quote: ... Anti-GFP mouse IgG (Roche Applied Science) was used at a dilution of 1:1.000 and it was visualized by incubation with goat anti-mouse IgG secondary antibodies conjugated to horseradish peroxidase (1:10.000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal antibodies targeting GFP/EGFP (Roche), ubiquitin P4G7 (Biolegend) ...
-
bioRxiv - Biochemistry 2021Quote: ... GFP/Venus (Roche, mouse monoclonal, cat. #11814460001).
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-HA tag (Roche, RRID: AB_2314622), and rabbit anti-HA Tag (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP (Mouse, Roche, 11 814 460 001), Phospho-TAO2 (S181 ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-GFP were from Roche; the mouse anti-FLAG was from Genscript (Nanjing ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-HA tag (Roche; RRID, AB_2314622), rabbit anti-HA Tag (Cell Signaling Technology ...
-
bioRxiv - Genetics 2022Quote: ... anti-HA antibody (12CA5 from mouse (Roche)) diluted 1:1,000 in blocking solution was used ...
-
bioRxiv - Genomics 2022Quote: ... Anti-GFP antibody from mouse (Roche 11814460001) at 1:1000 dilution and anti-H3 antibody from rabbit (Abcam ab1791 ...
-
bioRxiv - Plant Biology 2022Quote: ... and mouse monoclonal anti-GFP antibody (Roche, 11814460001 ...
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-HA tag (Roche, RRID: AB_2314622), rabbit anti-HA Tag (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-Myc-HRP (clone 9E10; Roche), mouse anti-VPS35 (clone 2D3 ...
-
bioRxiv - Cell Biology 2023Quote: ... or mouse anti-HA (Roche, Basel, Switzerland) antibody for one hour at 4 °C and then with DynabeadsTM Protein G for 45 minutes at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... or mouse anti-GFP (Roche, REF 11814460001) and anti-Myc antibodies (Roche ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... mouse anti-HA (12CA5 and 3F10, Roche), HRP-conjugated goat anti-mouse IgG (Jackson) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg RNA samples were reverse transcribed using a Transcriptor First Strand cDNA Synthesis Kit (Roche). RT-PCR was performed using a CFX Connect Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA (1 µg) was reversed transcribed with the Transcriptor First Strand cDNA Synthesis kit (Roche). Fragments of fz3 and wg were amplified and used for the templates for synthesizing antisense probes ...
-
bioRxiv - Pathology 2019Quote: ... Lysis buffer mix consisting of 100 μL Lysis buffer (Vial 1, Roche FFPET Isolation Kit # 06650775001), 100 μL dH2O ...
-
bioRxiv - Pathology 2019Quote: ... and 1 μg RNA was used for cDNA synthesis (Transcriptor first strand cDNA synthesis kit, Roche). INF2 was then PCR amplified from cDNA using isoform-specific primers (Supplementary Figure 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg total RNA was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with random hexamer primers according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA was obtained from epithelioids 1 week after medium change to mFAD or from mouse esophageal epithelium peeled and incubated with Dispase I (Roche catalog no. 04942086001) diluted at 1 mg/ml in PBS for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated from 1.0 μg of RNA using TaqMan Reverse Transcription (RT) Reagents and random hexamer primers (Roche, cat#N8080234). Equal volumes of cDNA were used for quantitative PCR (qPCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The purified PCR product was then used for an in vitro transcription reaction using the DIG RNA Labeling Mix (#11175025910, Roche, Germany) and T7 and Sp6 RNA polymerase to generate both sense and antisense probes ...
-
bioRxiv - Developmental Biology 2020Quote: A 257 bp digoxigenin-labeled RNA probe was generated from a region spanning exons 1-3 of cat Dkk4 using a PCR-based template (cDNA from Stage 16 cat embryonic epidermal cells; CCCTGAGTGTTCTGGTTTT, AATATTGGGGTTGCATCTTCC) and in vitro transcription (Roche Diagnostics). 10 μ M paraffin-embedded sections were deparaffinized with xylenes and antigen retrieval using 0.01 M citrate buffer ...
-
bioRxiv - Physiology 2021Quote: ... DNase treatment was performed on 300 ng RNA prior to Reverse Transcription Polymerase Chain Reaction (RT-PCR) using RNAse-free DNAse I (Roche, # 04716728001) at 37°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription product was used to perform quantitative PCR (qPCR) with a real-time PCR detection system (LightCycler®480; Roche). The 10-μl qPCR reaction mixture contained 1 μl cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... and plasmids were linearised to facilitate in vitro transcription of antisense riboprobes using either SP6 or T7 RNA polymerase and DIG-RNA labelling mix (Roche, 11277073910). All primers used to clone riboprobe sequences are listed in Extended Data Table 5.
-
bioRxiv - Plant Biology 2023Quote: ... Expression of mRNA and pre-mRNA was then assayed by semi-quantitative reverse-transcription PCR (qRT-PCR) on a Roche LightCycler480 using SYBR Green I (Roche Diagnostics). Raw fluorescence data were analysed using LinRegPCR to perform background subtraction ...
-
bioRxiv - Physiology 2024Quote: ... Fluorescein-labeled cRNA probes for esr1 and esr2a were generated by in vitro transcription using Fluorescein RNA Labeling Mix (Roche Diagnostics), SP6 or T7 RNA polymerase (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmid was cut and antisense probe was synthesized by in vitro transcription with Dig RNA Labeling Mix (Roche, Cat. No. 11277073910) or Fluorescein RNA labeling mix (Roche ...
-
bioRxiv - Immunology 2024Quote: ... reverse transcription was first carried out using High-Capacity RNA-to-cDNA and further quantified using Sybr Master mix I (Roche #04707516001). Relative gene expression over β-actin in cell lysates was calculated by the method while absolute N abundance in supernatants was quantified using the N normalizer plasmid.
-
bioRxiv - Microbiology 2024Quote: ... The mRNA transcript levels of selected IVSPER genes were measured by quantitative reverse transcription-PCR (qRT-PCR) using a LightCycler® 480 System (Roche) and SYBR Green I Master Mix (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2.55 nL of 72 Ad153-reverse-tag (1~72) primer [1 μM] made by KAPA HiFi HotStart PCR Kit (KK2500, Kapa Biosystems, Cape Town, South Africa). Finally ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP clone 7.1 and 13.1 (Roche), mouse-monoclonal anti-HA (Sigma ...