Labshake search
Citations for Roche :
601 - 650 of 1954 citations for 7 Diethylamino 3 2 thienyl coumarin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 2 mM MgSO4 and protease inhibitor cocktail (Roche cat# 04693132001)) was added and bacteria was incubated on ice for 15 min before centrifugation for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... they were blocked with 2% bovine serum albumin (BSA, Roche). Samples were incubated overnight at 4°C in the same blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with protease and phosphatase inhibitors (Roche) and lysates were sonicated followed by quantification using the Pierce BCA protein assay (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 tablets of cOmplete EDTA-free protease inhibitor cocktail (Roche), 0.1 mg/ml lysozyme ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml of the cOmplete His-Tag purification resin (Roche) equilibrated with the Tris buffer 4 containing 25 mM Tris-HCl (pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Microbiology 2023Quote: ... 1% P/S and 50 U/mL IL-2 (Roche), at 37°C and 5% CO2.
-
bioRxiv - Bioengineering 2023Quote: ... Collagenase B solution 2 mg ml−1 B (Roche, Indiana) was used for HUVEC isolation (detailed protocol in 10) ...
-
bioRxiv - Plant Biology 2024Quote: NATA1Δ and NATA2Δ were preincubated with 2 mM acCoA (Roche) and 5 mM of ligands (purchased from Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and then to MABT with 2% blocking reagent (Roche, 11096176001) at 4°C overnight ...
-
bioRxiv - Physiology 2024Quote: ... 2 × KAPA SYBR FAST qPCR Master Mix Universal (KAPA Biosystems), 5 μl of sample solution ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM benzamidine) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Light Cycler 96 system (Roche, Basel, Switzerland; Exp. 2). The species-specific primer-probe set for each target region of Ayu was shown in Table 1 (see Result) ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 supplemented with protease and phosphatase inhibitor cocktails (Roche)) for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 M NaCl with Complete protease inhibitor tablet (Roche, Indianapolis, IN) and centrifuged for 30 min at 13,000 rpm 4°C to pellet cell debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM EDTA) supplemented with EDTA-free protease inhibitor cocktail (Roche), phosphatase inhibitor (Roche) ...