Labshake search
Citations for Roche :
601 - 650 of 663 citations for 3 Acetyl N ethylpyridinium bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... (after a 3-hour fasting period) was measured by taking blood from the tail tip using an Accu-Chek glucometer (Roche Diagnostics). Mice then received an intraperitoneal (ip ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were lysed in 50 μl of Lysis Buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1x Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DIG-labeled 3’UTR of Emi2 and cyclin B1 RNA probes were synthesized with a DIG-RNA-labeling kit (Roche Molecular Biochemicals). Two μg of probes was incubated with purified Flag-tagged proteins for 15 min ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... N3500], 50 mM of Tris [pH 7.5], 150 mM of NaCl, 3 mM of MgCl2, 1X protease inhibitors [Roche, Mannheim, Germany; 05892953001]). Protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Genomics 2022Quote: ... Empty/filled PCRs (combining 5′ and 3′ flanking primers) and full-length PCRs (using junction-spanning primers) were performed using an Expand Long Range dNTPack (Roche, Cat#: 4829034001). Reaction mixes contained 5μL 5× Expand Long Range Buffer with 12.5mM MgCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were blocked for 1 h with 3% (w/v) non-fat milk powder in PBS/0.1% (v/v) Tween (PBST) (CALR, 10% Roche WBR in PBST) and incubated with primary antibody (Supplementary Table III ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Microbiology 2020Quote: ... and prepared for shotgun metagenomic sequencing using the Kapa Hyperprep Plus kit with 3 rounds of PCR amplification (Kapa Biosystems, Wilmington, MA), and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼0.5×106cells were collected and wash 3 times with Wash buffer (20 mM HEPES-KOH, pH 7.5,150mM NaCl, 0.5mM Spermidine, and Roche Complete Protease Inhibitor EDTA-free). Cells were captured with BioMagPlus Concanavalin A (Polysciences ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR reactions were carried out in triplicates following a 3-step amplification protocol using the LightCycler 480 system (Roche Diagnostics, Switzerland). The ΔΔCT method [94] was used to calculate gene expression changes relative to housekeeping genes β-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM β-mercaptoethanol (BME) and 0.3 μg/ml DNase I supplemented with 600 μl of protease inhibitor cocktail (Roche, Basel, Switzerland) and 5 mg lysostaphin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl, 10% sucrose, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 3 mM ATP, 1 mM PMSF and Roche protease inhibitors). Native mouse regulatory light chain (RLC ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Immunology 2024Quote: ... tissue sections (n = 2-3 per tissue type) underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reaction volumes were increased to 50 ul and 3 μl was subsequently used for qPCR reactions with SYBR Green (Roche, cat# 04887352001). Forward primers were designed at the 5’ ending of tRNAs and the reverse primers were designed against the 3’adapter while specificity was created against the 3’ endings ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The pellet was washed with the same cold nuclei extraction buffer (10 mM Tris–HCl pH 8.0, 10 mM MgCl2, 0.25 M sucrose, 3% triton X-100, 1% Roche protease inhibitor cocktail tablet) and then resuspended in nuclei purification buffer (20 mM MOPS pH 7.0 ...
-
bioRxiv - Plant Biology 2024Quote: ... were finely chopped into pieces in cold nuclei extraction buffer (10 mM Tris–HCl pH 8.0, 10 mM MgCl2, 0.25 M sucrose, 3% triton X-100, 1% Roche protease inhibitor cocktail tablet). The resulting mixture was filtered through a 40 μm cell sieve into a collection tube and centrifuged at 1,000 g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...