Labshake search
Citations for Roche :
601 - 650 of 3016 citations for 3' 5' Dimethyl 3 2 3 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... with probe prepared by nick translation of a double-stranded PCR product bearing the bcd ORF using alkali-stable digoxigenin-11-2’-deoxyuridine-5’-triphosphate (Roche), visualizing with alkaline-phosphate coupled sheep anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Cell Biology 2024Quote: ... then with 1 ml of Western blot buffer (2% SDS, 5% Glycerol, 50 mM Tris-HCl, 0.2 M EDTA + cOmplete protease inhibitor cocktail tablet (Roche, 11697498001) + PhosSTOP (Roche ...
-
bioRxiv - Immunology 2020Quote: ... The proliferation rate of lymphocytes was measured using 5-Bromo-2-deoxyuridine (BrDU) assay as per the manufacturer instructions (Cell Proliferation ELISA BrDU, Roche, USA).
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol in MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 300 mM MgAc ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Biophysics 2021Quote: ... Cell pellets were resuspended in Lysis Buffer (25 mM HEPES pH 8.0, 250 mM NaCl, 10 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol, 10% glycerol and supplemented with Roche cOmplete protease inhibitor) and sonicated ...
-
bioRxiv - Physiology 2023Quote: ... autofluorescence was quenched by treating paraffin-embedded sections with PBS/BSA (5%) for 2 h before performing TUNEL staining (Roche, Basel, Switzerland) according to the manufacturer’s protocol and using Proteinase K treatment ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µl of the samples’ cDNA was mixed with 5 µl of FastStart SYBR Green Master (ROX; Hoffmann-La Roche, Basel, Switzerland), 0.25 µl of each primer (final concentration 500 nM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM PMSF (Roche), 10% glycerol ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...