Labshake search
Citations for Roche :
6251 - 6300 of 7615 citations for 7 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the striatal/accumbal slices were sonicated in 300 µL lysis buffer (50 mM Tris-HCl [pH 7.5], 1 mM EGTA, 20 mM MgCl2, 500 mM NaCl, 0.5% NP-40, protease inhibitor cocktail [Roche] ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclear pellets were resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 7.5, 1X Roche protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Bacterial pellets were collected via centrifugation at 4°C and 5,000g and resuspended in ice-cold lysis buffer (50 mM MES pH 6.8, 1 mM EGTA, 0.2 mM MgCl2, 5 mM DTT, Roche complete protease inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Plant Biology 2024Quote: ... supplemented with 1 tablet of protease inhibitor cocktail per 10 ml buffer (cOmplete™ Proteasehemmer-Cocktail, ©Roche) with an ultrasonic homogenizer (Hielscher Ultrasonics UP200St ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Developmental Biology 2024Quote: ... harvested and lysed 14 h later in 300 µl binding buffer (20 mM HEPES pH 7.6, 150 mM MgCl2, 10% glycerol, 0.05% NP-40, 1 mM DTT, ROCHE cOmpleteTM ULTRA-tablet Mini protease inhibitor) ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in 150 µl of lysis buffer (PBS 1X, 1% protease inhibitor cocktail EDTA-free, Roche) and lysed by sonication (amplitude 70% ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were dewaxed and antigen retrieval was performed using Discovery Cell Conditioning 1 (Roche Tissue Diagnostic, ref. 06414575001) for 32 minutes at 95°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were dewaxed and antigen retrieval was performed using Discovery Cell Conditioning 1 (Roche Tissue Diagnostic, ref. 06414575001) for 32 minutes at 95°C.
-
bioRxiv - Biochemistry 2024Quote: ... Frozen cell pellets were resuspended in Lysis Buffer (50 mM HEPES [pH 7.5], 100 mM NaCl, 1 mM NaF, 0.1% βME with Roche EDTA-free protease inhibitor tablets ...
-
bioRxiv - Microbiology 2024Quote: HIV-1 RNA levels were measured in cell-free CSF and plasma at each site using the ultrasensitive Amplicor HIV-1 Monitor assay (versions 1.0 and 1.5; Roche Molecular Diagnostic Systems ...
-
bioRxiv - Cell Biology 2024Quote: The parasite culture was pelleted and suspended in PBS containing 1 × complete protease inhibitor cocktail (Roche, Basel, Switzerland). Saponin (at a final concentration of 0.15% ...
-
bioRxiv - Microbiology 2024Quote: ... 500mL of Buffer 1 (20mM KHEPES pH 7.9, 50mM KCl, 10% Glycerol) with a protease inhibitor tablet (Roche) was added and samples were subject to ultrasonication in a cup horn sonifier (Branson ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM MgCl2, 0.1% NP-40, 5 mM DTT, 0.5 mM PMSF, 1× EDTA-free protease inhibitor cocktail [Roche] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.5 % SDS, 1#x00D7; protease inhibitor cocktail from Roche). The resulting nuclei were spun down ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... 1% Triton X-100, 0.1% sodium deoxycholate, 1mM EDTA, 5mM MgCl2, 1mM DTT, 0.5mM PMSF, 10mM NaF, Roche PhoSTOP ...
-
bioRxiv - Plant Biology 2024Quote: ... 1mM DTT and 20 mM imidazole supplemented with 1 tablet of cOmplete™ EDTA-free protease inhibitor (Roche) per every 50 ml ...
-
bioRxiv - Plant Biology 2024Quote: ... Tissues were ground with mortor and pestle and resuspended in 30 mL extraction buffer 1 (10 mM Tris-HCl, pH 8.0, 5 mM βmercaptoethanol, 0.4 M sucrose, protease inhibitor cocktail (cOmplete, Roche), vortexed ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... washed with cold PBS and then lysed for 4 hours on rotation at 4°C in TNEN buffer (50 mM Tris pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.1% NP-40, Protease inhibitors (Roche) and phosphatase inhibitors (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... followed by a subsequent incubation at 95 °C in pre-formulated Cell Conditioning 1 solution (Roche Diagnostics, Canada). Following this ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 72°C for 1 min) All PCR was performed using KAPA HiFi HotStart ReadyMix (Kapa Biosystems; KK2602). The PCR products were isolated by QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were stopped by adding 0.5 μl ethylenediaminetetraacetic (0.5 M EDTA) and 1 μl Proteinase K (19 mg/ml, Roche), and incubated at 50°C for 30 min ...
-
bioRxiv - Pathology 2024Quote: ... Pre-cleared lysates (containing 1 mg of protein) were then incubated with mouse monoclonal anti-GFP antibodies (Roche) coupled to G-protein beads for 3 h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cell pellets were then resuspended in 400 uL Lysis buffer (1% SDS, 50 mM Tris Hcl pH 8.0 20 mM EDTA, protease inhibitors (Roche) and incubated on ice for 10 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... in liquid nitrogen in a 1.5-ml Eppendorf tube and resuspended in ice-cold lysis buffer (50 mM Tris pH 7.6, 10 mM EDTA, 150 mM NaCl, 1% Triton, supplemented with complete protease inhibitor, Roche Ref ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... The pellet was lysed with 20 ml of Eps8L2 Lysis Buffer (10 mM Tris.HCLpH8, 150 mM NaCl, 1 mMEDTA, lysozyme 0.1 mg/ml, Pefabloc® (Roche) 0.5 mg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were resuspended in lysis buffer supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: ... pH 8.0, 100 mM NaCl, 5mM MgCl2, 1% Triton X-100, 1mM PMSF, and complete protease inhibitor cocktail; Roche) and lysed twice with high pressure (1200 psi ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic beads were washed 2 times with lysis buffer and 4 times with washing buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mg/ml Pefabloc SC (Roche), and EDTA-free protease inhibitor cocktail (cOmplete Tablets ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed once with 1 mL ddH2O and resuspended in 100 μL lysis buffer (50 mM Tris, pH 7.4, 50 mM dithiotreitol, 1 mM EDTA, cOmplete EDTA-free protease inhibitor cocktail (Roche) and Phosstop (Roche) ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... The lysis was performed in RIPA buffer (1% SDS, 10 mM Tris pH 8.0, containing protease and phosphatase inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000; Roche). Primers used for generating PCR templates are listed in Key Resources Table.
-
bioRxiv - Immunology 2021Quote: ... Tissue homogenates were resuspended in 1x lysis buffer (1% NP-40, 100mM Tris, pH 8.0, and 150mM NaCl) containing a protease inhibitor mixture (Roche) and shaken 60 mins at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking powder from Roche, 5X SSC, 0.1% TritonX, 0.1% CHAPS from Sigma Aldrich, 50% formamide, 1 mg/ml tRNA from Roche, 5 mM EDTA from Sigma and 50 μg/ml Heparin from Sigma ...
-
bioRxiv - Biophysics 2021Quote: ... The cell pellet was resuspended in 1 ml of polysome lysis buffer supplemented with EDTA-free protease inhibitors (Roche) and was grounded in liquid nitrogen using an RNase-free mortar and pestle ...
-
bioRxiv - Developmental Biology 2021Quote: ... Eye discs were then removed from the mouth hooks and blocked for 1 hour in 1X PBX:Western Blocking Reagent (Roche) at room temperature with nutation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... tissue was incubated with POD (horseradish peroxidase) conjugated anti-DIG or anti-FLR secondary antibodies (1:100 dilution, Roche Diagnostics ...
-
bioRxiv - Immunology 2021Quote: ... were lysed using for one hour with ice-cold 1% NP-40 lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA) supplemented with complete mini (Roche) and HALT (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...