Labshake search
Citations for Roche :
6101 - 6150 of 6323 citations for Rat Myristoylated Alanine Rich C Kinase Substrate MARCKS ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: One microgram of RNA of each isolate was converted into cDNA using the Transcriptor high-fidelity cDNA synthesis kit (Roche, Basel, Switzerland). RT-PCR was performed in 96-well plates using the PowerUp SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of ligated fragments in each library was quantified with the KAPA Library Quantification Kits for Illumina platforms (Roche/KAPA Biosystems, KK4824) on a Roche LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The bulk transcriptome of these cases was obtained after macrodissection of the whole tumor area on the same block as the one used for the IHC and obtained from FFPE sections using a high-purity FFPE RNA isolation kit (Roche, Basel, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... a maximum of 1 μg of sheared DNA was used for library preparation using the KAPA HTP Prep Kit (KAPA Biosystems, KK8234) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Cytotoxicity was assessed by measuring the release of lactate dehydrogenase (LDH) into the culture supernatant using the cytotoxicity detection kit PLUS (Roche, Basel, Switzerland). 100 μl cell-free supernatant ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2023Quote: ... Final quantification of the RNA-seq library was done with the Library Quantification Kit for Illumina® platforms (KAPA Biosystems, M.A, U.S.A.). The C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The primary antibody was either visualized with the multimer-technology based UltraView Universal DAB Detection kit (Ventana® BenchMark® XT; Roche) or a fluorochrome-labeled secondary antibody (Alexaconjugated ...
-
bioRxiv - Pathology 2023Quote: Cell death was assessed in tissue sections using terminal deoxynucleotidyl transferase-mediated dUTP nick- end labeling (TUNEL, Roche TUNEL kit (12156792910; Roche, Basel, Switzerland), as previously described (Cade et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Deletion of FGSG_09786 was further verified by Southern blot with the Digoxigenin High Prime DNA Labeling and Detection Starter Kit I (Roche, Mannheim, Germany). Using a similar strategy ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR analysis was carried out using the qScript One-Step PCR kit (Quanta Biosciences, Gaithersburg, MD) on a LightCycler 96 System (Roche, Indianapolis, IN). Fold-change values were calculated using the 2-ΔΔCt method ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 min or TRAP staining with a TRAP/ALP Stain Kit (FUJIFILM Wako Pure Chemical Corporation) for 30 min or ALP staining with NBT/BICP solution (Roche; 1:100) for 15 min followed by AR staining prepared from 1% AR Solution at pH 6.3-6.4 (MUTO PURE CHEMICALS CO. ...
-
bioRxiv - Evolutionary Biology 2023Quote: The Illumina library was prepared with 250 ng of unsheared DNA using the Kapa Hyperplus Library Preparation Kit with only one third of the volume reactions as described in the manufacturer’s protocol (Kapa Biosystems, Wilmington, MA). The total fragmentation volume was 16.66 μl and was incubated at 37°C for 7:45 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: Paired-end sequencing libraries for QTL-Seq analysis were prepared using >1 μg of pooled DNA with a KAPA HyperPrep PCR-free kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... while supernatants from enriched soil/water samples and rectal swabs were extracted using the High Pure PCR Template Preparation kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA-seq directional libraries were generated for 1 μg rRNA-depleted RNA using the KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, KK8421). The rRNA-depleted RNA was fragmented ...
-
bioRxiv - Genomics 2024Quote: ... Both DNA samples were also converted into Illumina sequencing libraries with the KAPA HyperPrep library construction kit (Roche Sequencing Solutions, Indianapolis, IN) and paired-end sequenced for 150 cycles on a NovaSeq6000 (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche cat# KK4824) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Neuroscience 2024Quote: ... Accurate quantification of the final libraries for sequencing applications was determined using the qPCR-based KAPA Biosystems Library Quantification kit (Kapa Biosystems, Inc.). Each library was diluted to a final concentration of 1.4 nM and pooled equimolar prior to clustering ...
-
bioRxiv - Neuroscience 2024Quote: ... A DNA library targeting polyadenylated transcripts was constructed for each sample in a 12-cycle PCR (100ng total RNA, KAPA hyper mRNA stranded library prep kit, Roche, catalogue# KK8581). Final cDNA libraries were checked for quality by TapeStation and qPCR (Kapa’s library quantification kit for Illumina Sequencing platforms ...
-
bioRxiv - Neuroscience 2024Quote: ... Final cDNA libraries were checked for quality by TapeStation and qPCR (Kapa’s library quantification kit for Illumina Sequencing platforms, catalogue# KK4835, Kapa Biosystems, Wilmington MA). Samples were clustered and sequenced using NovaSeq S2 reagents (NovaSeq S2 Run ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA was isolated from tail clips taken from neonatal mice during sacrifice using the Kapa Express Extract Kit (Kapa Biosystems, Cat. #KK7100) with one minor modification – sample lysis was assisted via physical homogenization using a 1.5 mL tube plastic pestle ...
-
bioRxiv - Evolutionary Biology 2024Quote: A PCR free Illumina library (based on the same HMW extraction) was prepared using the Kapa Hyper Prep Kit (Roche, Basel, Switzerland), following manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The relative expression of genes in leaves was determined by reverse transcription quantitative PCR performed on an Applied Biosystems StepOne Real-Time PCR System with KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) according to the protocol of the manufacturer ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for library quantitation (Kapa Biosystems, Woburn, MA) both immediately prior to and after library construction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNAseq libraries were prepared in a single batch by the Bauer Core at Harvard using the KAPA mRNA HyperPrep Kit (Roche, Palo Alto, CA) with 300-500 nanograms of input RNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
bioRxiv - Genomics 2020Quote: ... Library concentrations were determined by quantitative polymerase chain reaction (qPCR) using the KAPA SYBR FAST ABI Prism qPCR Kit (Kapa Biosystems, Wilmington, MA) and the StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... cDNA libraries were prepared using 500 ng of large RNA as input for the KAPA mRNA HyperPrep Kit (Kapa Biosystems; Wilmington, MA, USA) combined with the KAPA Unique Dual-Indexed Adapter Kit (Kapa Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified in 50 μl reactions containing 150 pmol of P1.1 and P3 primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). The amplification was incubated at 95°C for 45 seconds ...
-
bioRxiv - Pathology 2020Quote: ... the sequence was labeled with digoxigenin using the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics Deutschland GmbH, Germany). After dewaxing in water ...
-
bioRxiv - Physiology 2019Quote: ... PCR was carried out with KAPA SYBR® FAST Universal 2X qPCR Master Mix (Cat# KK4601) / LightCycler 480 SYBR Green I Master kit (Roche Cat# 14712220) in Vapo.Protect Eppendorf LC-480 and LC-96 from Roche system using primer pairs mentioned in Supplementary Table A.
-
bioRxiv - Neuroscience 2021Quote: 100ng of total RNA from each sample was used to prepare total RNA libraries using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems, Massachusetts, USA). Fragmentation prior to first strand cDNA synthesis was carried out using incubation conditions recommended by the manufacturer ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... no AS-MB-006) and RNA libraries were prepared using the KAPA Stranded RNA-seq library preparation kit (Kapa Biosystems, cat. no KK8401) according to manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2021Quote: ... the quantitative real-time PCR (qRT-PCR) reactions were carried out using the KAPA SYBR FAST qPCR kit from Kapa Biosystems (MA, USA) with sfGFP-specific primer sets (Supplementary Table 4) ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Microbiology 2020Quote: ... 1μg of total RNA was reverse-transcribed to complementary DNA (cDNA) using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantification of mcherry and gyrB (single gene copy on the plasmid and on the chromosomal DNA respectively) copy number was made from 25 pg of DNA using the LightCycler® FastStart DNA Master HybProbe kit (Roche, Bâle, Switzerland) following manufacturer’s instructions with appropriate oligonucleotides and Taqman probes (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Kapa Biosystems Cat#KK4824).
-
bioRxiv - Microbiology 2021Quote: ... to check for size and quantified by qPCR using the Kapa Library Quantification Illumina/ABI Prism Kit protocol (KAPA Biosystems, Wilmington, MA, USA). Equimolar quantities of each library were then pooled and sequenced on the Illumina NovaSeq 6000 instrument with a SP flowcell (2 x 250 bp ...
-
bioRxiv - Microbiology 2020Quote: ... the sections were incubated with a primary antibody for 32 min at room temperature and then incubated with the reagent from an iVIEW DAB detection kit (Roche Diagnostics, Meylan, France). The sections were counterstained with hematoxylin and post-counterstained with bluing reagent ...
-
Dissemination of linezolid-resistance through sex pheromone plasmid transfer in Enterococcs faecalisbioRxiv - Microbiology 2019Quote: ... blots were hybridized with digoxigenin (DIG)-labeled optrA-specific probe using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Sciences, Germany) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... Barcode-indexed sequencing libraries were generated from reverse-crosslinked ChIP-DNA samples using a Kapa Hyper DNA Library Preparation Kit (Kapa Biosystems-Roche, Basel, Switzerland) and NextFlex UDI adapters (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... The sample DNA underwent end-repair and A-tailing with conditions of 20C for 30 minutes and 65C for 30 minutes (Roche KAPA HyperPrep kit). We ligated native barcodes using 5ul of each barcoded adapter (EXP-NBD196 ...
-
bioRxiv - Microbiology 2022Quote: ... tissues were processed using the Discovery Ultra automated stainer (Ventana Medical Systems) with a ChromoMap DAB kit (Roche Tissue Diagnostics cat#760-159). Specific immunoreactivity was detected using the GenScript U864YFA140-4/CB2093 NP-1 SARS-CoV-2-specific antiserum at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DNA molar concentration of the library was quantified with the KAPA Library Quantification Kit Illumina® Platform (KAPA Biosystems, Woburn, MA, USA). Libraries were sequenced using an Illumina HiSeq® X Ten System with paired-end reads by Beijing Yuanyi Biotechnology Co. ...
-
bioRxiv - Immunology 2022Quote: ... Library for RNA-Seq was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kit with 201-300bp insert size (KAPA Biosystems, Wilmington, MA) using 250 ng total RNAs as input ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboseErase (v2.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...