Labshake search
Citations for Roche :
5951 - 6000 of 9048 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ChIP-seq DNA libraries were prepared using the KAPA HyperPrep Kit (Roche, # KK8504) and sequenced on the Illumina NextSeq 500 system ...
-
bioRxiv - Neuroscience 2024Quote: ... and their concentrations were measured using the KAPA SYBR Fast qPCR kit (Roche). Samples were sequenced on the NovaSeq 6000 instrument (paired end ...
-
bioRxiv - Molecular Biology 2024Quote: ... and quantified by qPCR using KAPA Library Quantification Kits (Kapa Biosystems, Cat# KK4824). The library was sequenced on the Illumina NovaSeq 6000 for 51 cycles of paired-end sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... The mRNA library was prepared using the Kapa mRNA HyperPrep Kit (Kapa Biosystems) and sequenced on the Illumina HiSeq 3000 system ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and library preparation was carried out using the KAPA Hyper Prep kit (Roche) and using the NEBNext® Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: ... were performed using the KAPA HiFi polymerase kit (Roche Sequencing Solutions, Pleasanton, CA) and a T100 Thermal Cycler (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from cells using High Pure Isolation Kit (Roche, 11828665001) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2024Quote: ... Metagenomic libraries were constructed with the DNA Hyper Prep kit (Kapa Biosystems-Roche) and sequenced (paired-end ...
-
bioRxiv - Genomics 2024Quote: ... Metagenomic libraries were constructed with the DNA Hyper Prep kit (Kapa Biosystems-Roche) and sequenced (paired-end ...
-
bioRxiv - Neuroscience 2024Quote: ... 30 ng of gDNA was enzymatically fragmented using the KAPA HyperPlus Kit (Roche). Samples were purified at 0.8X using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems, KK4873) and submitted to sequencing in NovaSeq 6000 System with 2 × 50 bp reads on SP flow cell.
-
bioRxiv - Immunology 2024Quote: ... Amplified libraries were quantified using a KAPA SYBR Fast qPCR Kit (KAPA Biosystems) and its size distribution was analyzed by a MultiNA ...
-
bioRxiv - Genetics 2024Quote: ... RNA sequencing libraries were prepared using the KAPA mRNA HyperPrep Kit V2 (Roche). Paired-end 100x100 bp sequencing was performed on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... Each DNA library was quantified using Roche KAPA Library Quantification Kit (Roche #0796014000) and pooled for sequencing on an Illumina NextSeq2500.
-
bioRxiv - Synthetic Biology 2024Quote: ... The final indexed libraries were quantified using KAPA Library Quantification Kit (Roche 7960140001) for pooling and sequenced at 2x150 cycles on NovaSeq X Plus by Novogene.
-
bioRxiv - Molecular Biology 2024Quote: ... and the KAPA RNA Hyper + RiboErase HMR kit was used (Roche, catalog 8098131702) following kit instructions for library prep using KAPA beads (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell viability was analyzed using the XTT cell proliferation kit II (Roche Diagnostics). Drug treatment was started 24 h after cell seeding ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2024Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were cleaned up using the High Pure PCR Product Purification Kit (Roche) and sequenced by LGC Genomics GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... the super pools were quantified using the Kapa qPCR Illumina quantification kit (Kapa Biosystems) prior to sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Postamplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter and were quantified using the Library Quantification Kit from Illiumina (Kapa Biosystems, KK4603). Libraries were pooled to a final concentration of 10nM and sequenced single-end using the Illumina HiSeq 4000.
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were generated using the Kapa RNA HyperPrep kit with RiboErase (HMR, Kapa Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tail genomic DNA was extracted using a KAPA mouse genotyping Kit (KAPA Biosystems KK7352), and PCR was performed using primers as described in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems). Average size fragment was determined using a LabChip GX (PerkinElmer ...
-
bioRxiv - Cell Biology 2020Quote: ... and apoeb transcripts were generated using the DIG RNA Labeling Kit (Roche Applied Science) from linearized plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... The rDNA and telomere probes were labeled by nick translation kit (Roche, Basel, Switzerland). The chromosome 3 painting probe was labeled with ATTO-550 as previously described (Albert et al. ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... Custom DIG-labeled probes were generated using PCR DIG Probe Synthesis Kit (Roche #11636090910) and blots were hybridized for 16 hours at 48°C with a final concentration of 25ng/ml probe in 10ml DIG EasyHyb buffer rolling in hybridization tubes ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was extracted from recombinant clones with the High Pure Isolation kit (Roche) as directed by the manufacturer and sequenced in an ABI PRISM 3100 genetic analyzer (Applied Biosystem ...
-
bioRxiv - Genetics 2021Quote: We generated RNA-seq libraries using the KAPA Stranded mRNA-seq kit (KAPA Biosystems) from 500 ng RNA for each library and did 150 bp pair-end sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cDNA synthesis was performed with the cDNA synthesis kit (Roche Product No: 11483188001). ΔCt values were measured using the “Multiple Plate Analysis” program ...
-
bioRxiv - Genomics 2020Quote: ... MeDIP library DNA concentrations were estimated using the Kapa Library Quantification kit (Kapa Biosystems) and were further verified by running on an Agilent High Sensitivity DNA chip on an Agilent 2100 BioAnalyzer ...
-
bioRxiv - Genomics 2020Quote: ... The generated paired-end libraries were quantified by qPCR (KAPA Library Quantification Kit, Roche) and then sequenced at the Federal University of Rio Grande do Sul ...