Labshake search
Citations for Roche :
551 - 600 of 5323 citations for Total Carbohydrate Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized from 1 μg of total RNA with Transcriptor (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using TriPure Reagent (Roche Applied Science, Mannheim, Germany) and purified using an RNeasy Mini Plus Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: Escherichia coli MRE600 total transfer ribonucleic acid was purchased from Roche (Switzerland). Biotin labeled single-stranded DNA oligonucleotides were obtained from B.G.I. ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were performed in 5 μl total volume on LightCycler 480 (Roche) as described previously (Petek et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ten µg of total RNA was treated with DNase I (Roche, 4716728001) and 40 picograms of Luciferase Control RNA (Promega L4561 ...
-
bioRxiv - Systems Biology 2023Quote: ... Total RNA was digested with 10 units of DNase I (#04716728001; Roche) for 30 minutes in 10-8 10 µl reactions containing 5 µg of RNA ...
-
bioRxiv - Biochemistry 2023Quote: ... total RNA from cultured cells was isolated using TriPure isolation Reagent (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... a total of 121 μL of 2× Kapa HiFi HotStart ReadyMix (Roche), 9.68 μL of PCR_PF (10 μM) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Glycogen assays (Pointe Scientific G7521-500, Roche 10102857001, Thermo Sci J16445-06), triglyceride assays (Pointe Scientific T7532-120 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was evaluated using the colorimetric WST-1 assay (Roche Diagnostics). After a 4-h incubation period with WST-1 reagent the absorbance was measured at 450 nm/ 600 nm using a microplate reader (ELISA-Reader Zenyth 200st ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... And then qPCR assays were performed on the LightCycler 480 II (Roche) in 10μL reaction volume containing 6μL of SYBR green Master mix (Fisher Scientific A25918) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured by WST-1 assay following manufacture’s protocol (Roche). The IC50 and CC50 were calculated using a four-parameter logistic regression model from the GraphPad Prism 5 software (GraphPad Software Inc.).
-
bioRxiv - Bioengineering 2021Quote: Primers were designed using the Universal Probe Library Assay Design Center (Roche) and checked for specificity against the Physcomitrella transcriptome in the Phytozome database (Goodstein et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The assay was followed according to the manufacturers protocol (Roche Applied Science).
-
bioRxiv - Cell Biology 2021Quote: ... Te assay was performed according to the instructions of the vendor (Roche). The population doubling time was computed as the ln(2)/slope of the proliferation growth curve using Prism software ...
-
bioRxiv - Biochemistry 2022Quote: ... TUNEL assay was carried out according to manufacturers instructions (Roche Diagnostics, IN). Primary antibodies were visualized with species-specific secondary antibodies conjugated to fluorescent probes ...
-
bioRxiv - Biophysics 2022Quote: ... Cytotoxicity was also performed at matched concentrations using the MTT assay (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Center (Roche). Quantitative PCR was carried out using a LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... All qPCR assays were carried out on a LightCycler 480 (Roche Diagnostics) using the LightCycler 480 software version 1.5.1.
-
bioRxiv - Microbiology 2023Quote: ... qPCR assays were performed with a Light Cycler 480 II instrument (Roche), using the Maxima TM SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2023Quote: ... The qPCR assays were done with FastStart Essential DNA Green Master (Roche) with the primers are listed in supplementary methods.
-
bioRxiv - Cell Biology 2024Quote: ... WST-1 assays to measure cell proliferation rate (Roche Cat. No. 5015944001) were conducted using the manufacturer’s protocol.
-
bioRxiv - Systems Biology 2019Quote: Total RNA was extracted from fresh PBMCs using TriPure isolation reagent (Roche, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNAs were prepared from 1 µg of total RNA with random hexamers (Roche) and the Superscript III reverse transcriptase kit (Invitrogen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli total tRNA mixture (from strain MRE600) and phosphoenolpyruvate were purchased from Roche Applied Science ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng total RNA were reverse-transcribed with Transcriptor Reverse Transcriptase (Roche Diagnostics) using the primer 4/5_Re ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from a 200µL sample using the MagnaPure24 (Roche) External Lysis Pathogen 200 protocol with elution into 50 µL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in a total volume of 50 μL using Kapa polymerase (Kapa Biosystems #KK2502) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA (1 µ g) was analyzed using the digoxigenin (DIG) system (Roche). A DIG-labeled probe for PlAMV RNA detection was produced as described previously (16) ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μg of total RNA was incubated with recombinant DNase I (Roche, 04716728001) for 30 min at 37°C and the reaction was stopped by incubation at 75°C for 10 min ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA (2 µg) was treated with 10 units of DNase I (Roche) for 30 min at 37°C and then for 15 min at 70°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR system (20 μL in total) contained 2×SYBR Green Mix (Roche) 10 μL ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli total tRNA mixture (from strain MRE600) and PEP was purchased from Roche Applied Science (Indianapolis ...
-
bioRxiv - Plant Biology 2020Quote: ... Total proteins were extracted in the extraction buffer containing protease inhibitor cocktail (Roche) as described above ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from dorsal skin using TriPure Isolation Reagent (11667157001, Roche) and treated with DNase I (#EN0521 ...
-
bioRxiv - Genetics 2021Quote: Total proteins were extracted using protein extraction reagents (Roche Diagnostics Ltd., Shanghai, China) from the myocardial tissue of rats ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was reverse transcribed from total RNA using expand reverse transcriptase (Roche, USA) and oligo-dT primer ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from Tripure-treated samples (Roch Diagnostics Roche, Mannheim, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... β-galactosidase (lacZ) activity was measured in total cell lysates using CPRG (Roche) as a substrate ...
-
bioRxiv - Molecular Biology 2023Quote: Total protein extracts were prepared in RIPA buffer with protease inhibitor cocktail (Roche). Samples were sonicated for 3 minutes alterning 30seconds ON/ 30seconds OFF ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were centrifuged and cell killing assessed using the LDH Assay (Roche #11644793001) according to the manufacturers protocol using the SPECTROstar Nano (BMG Labtech).
-
bioRxiv - Genetics 2020Quote: ... Relative qPCR assays were performed using the LightCycler 480 qPCR system from Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2021Quote: ... The proliferation assay was carried out following the manufacturer’s instructions (Roche, Indianapolis, IN) at 24 and 72 hours ...
-
bioRxiv - Immunology 2019Quote: ... Libraries were checked for quality control with KAPA qPCR QC assay (KAPA Biosystems). The libraries (33 total ...
-
bioRxiv - Genomics 2019Quote: ... The library was quantified using a real-time qPCR assay (Lightcycler 480 Roche) with the universal Illumina adapter sequences IS7 and IS8 as targets ...
-
bioRxiv - Physiology 2019Quote: ... Normalized SIRT1 amount was used for activity assays using calf thymus histones (Roche), as indicated below.