Labshake search
Citations for Roche :
551 - 600 of 7724 citations for 6 Chloro 1 2 4 triazolo 4 3 b pyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Genetics 2021Quote: ... each sample was amplified in 6/2 PCR reactions (2 µg DNA/reaction) in the primary/secondary screens using the ReadyMix Kapa polymerase (Roche) with a total of 20 cycles and an annealing temperature of 55°C (Primer sequences in Table S4 ...
-
bioRxiv - Developmental Biology 2019Quote: ... then incubated overnight at 4°C with anti-DIG antibody (Roche #11093274910) at 1:5000 in block ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 4 μL of 500 ug/ml RNase (Roche, Cat. No 11119915001) was added and incubated for 1 h at 37° C to digest RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and visualized by staining with 4-nitro blue tetrazolium (NBT, #11383213001, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Neuroscience 2020Quote: Animals were perfused and post-fixed overnight using 4% paraformaldehyde (HistoFix, Roche). Vibratome sections (100-200 μm ...
-
bioRxiv - Immunology 2021Quote: ... Live/dead cell exclusion was performed with DAPI (4′-phenylindole dihydrochloride; Roche) or LIVE/dead fixable dye (Thermofisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated with 4 μl of DIG-Prime kit (Roche, Mannheim, Germany), overnight at 37°C ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... overnight at 4 °C in presence of protease inhibitor cocktail (Roche, Switzerland). The beads were washed with buffer W ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mM DTT) supplemented with 2x Complete EDTA free protease inhibitor (Roche). Samples were spun at 30,000 g for 10 min at 4°C and the cleared lysate was incubated with 40 µl anti-FLAG agarose bead slurry (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... proteinase K (4 µg/ml; F. Hoffmann La Roche Ltd, 211 Switzerland) and by heating at 96°C for 20 min in EnVisionTM FLEX Target Retrieval solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... were incorporated by PCR (4 cycles) using KAPA HiFi Hotstart ReadyMix (Roche).
-
bioRxiv - Genomics 2023Quote: ... 4 μL of Lysis mix (Proteinase K (5.05 mg/mL, Roche, 3115879001), IGEPAL CA-630 (5.05% ...
-
bioRxiv - Microbiology 2023Quote: ... 250 μL lysis buffer (4% w/v SDS and cOmplete Tablets (Roche) in 50 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2024Quote: ... then incubated overnight at 4°C with anti-DIG antibody (11093274910, Roche) at 1:5000 in blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Immunology 2021Quote: ... tumors were excised and digested with 1 mg/mL collagenase B (Roche) and 0.02 mg/mL DNaseI (D5025 from Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled tissue from each brain region was suspended in 6 ml of 0.32 M sucrose homogenization buffer (4 mM HEPES, 0.1 mM CaCl2, 1 mM MgCl2, plus Roche protease inhibitor tablet) and homogenized with a Teflon homogenizer using 10 strokes at 900 rpm ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... The digested DNA was separated in a 1 % agarose gel at 50 Volts for 72 hours at 4°C and transferred to a nylon membrane (Roche®) overnight ...
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... for 3-4 hours at room temperature followed by overnight incubation at 4°C in anti-DIG-AP Fab fragments (1:5000) (Roche 1093274). Embryos were washed with PBST followed by an alkaline tris buffer ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was then discarded and the pellet was resuspended in 300 µL SDS buffer (4 % SDS, 10 mM EDTA, 25 mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) and incubated at room temp (10 minutes) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at room temperature and incubated with an appropriate antibody overnight at 4°C: 1:3000 anti-DIG-AP (Roche 11093274910), 1:1000 anti-DIG-POD (Roche 11207733910 ...
-
bioRxiv - Cancer Biology 2022Quote: Engineered monoallelic cell pellets (500 million cells/sample) were lysed at 4°C in 1% CHAPS (Roche Diagnostics, cat no. 10810126001) lysis buffer (pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Cancer Biology 2022Quote: ... B cells were thawed in B cell medium containing DNAse (Pulmozyme, Roche) 20 h before use in co-culture assays ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...