Labshake search
Citations for Roche :
551 - 600 of 7456 citations for 6 Chloro 1 phenylsulfonyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then incubated overnight at 4°C in primary antibody dilutions in freshly prepared BBT+ buffer (PBST + 1% BSA + 0.5 mM Spermidine + 2 mM EDTA + 1 large Roche complete EDTA-free tablets). Primary antibody was replaced with BBT+ buffer and quickly washed twice ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl of 1:10 diluted DNA or cDNA and the SYBR Green I Master mix (Roche). We used PCR conditions adapted from Henneberger et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 M NaCl 1 mM TCEP) supplemented by one protease inhibitor cocktail tablet Complete EDTA-free (Roche) and centrifuged for 30 min at 18,000 g 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2021Quote: ... which was suspended into 1 ml cold Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and 5 μl Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: A subcutaneous dose (1 or 2 mg/kg of weight) of diazepam (DZPM, Valium ®, Roche; México) or saline solution (SAL ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with 1 ml lysis buffer (0.5 % Nonident-P40, 2 % protease inhibitor cocktail (Roche, Switzerland) and 1 % phosphatase inhibitor cocktails I and II (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... were lysed in 100 µL or 300 mL RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% IGEPAL CA-630, 0.25% Na-deoxycholate, 2 mM EDTA, 0.1% SDS, Roche cOmplete™ Mini protease Inhibitor Cocktail) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM tris(2-carboxyethyl)phosphine (TCEP) and protease inhibitor (cOmplete EDTA-free Protease Inhibitor Cocktail, Roche)) ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.15% NP40, 1 x Complete protease inhibitors, Roche) and rotated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with the primers listed in the section above ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Cell Biology 2021Quote: ... Muscles were dissociated and digested in RPMI medium containing 0,2% of collagenase B (Roche Diagnostics GmbH 11088815001) at 37°C for 1 hr and passed through a 70 μm and a 30 μm cell strainer (Miltenyi Biotec) ...