Labshake search
Citations for Roche :
551 - 600 of 6988 citations for 6 1 4 Dioxa 8 azaspiro 4.5 dec 8 yl 3 pyridinyl boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were diluted 1:4 with ice-cold dilution buffer (1× phos-stop [Roche], 0.5% NP-40, 1 mM DTT) and centrifuged again at 15,000 rpm for 15 minutes at 4°C to precipitate actomyosin components ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with a total of 1 µg of DNA using Fugene 6 (Roche, Branchburg, NJ) according to the manufacturer’s instructions
-
bioRxiv - Biochemistry 2020Quote: ... plus 6 protease inhibitor tablets (Roche) per liter of lysis buffer ...
-
bioRxiv - Genetics 2020Quote: ... using FuGENE 6 transfection reagent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... either Fugene 6 (Roche Applied Science) or Transporter 5 transfection reagents were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 mg/ml dispase (Roche Applied Science ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... the medium was replaced by serum free DMEM supplemented with 1% fatty acid free BSA (Roche Applied Sciences) and a mixture of oleate and palmitate (ratio 2:1 ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1% deoxycholic acid and protease inhibitors (Roche), and thrice with lysis buffer without detergent ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.5% fatty acid-free BSA (Roche), 10 mg ml-1 Collagenase D (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subject to anti-GFP immunoprecipitation using GFP-Trap beads or anti-Myc immunoprecipitation using Myc-Trap beads (ChromoTek) ...
-
bioRxiv - Plant Biology 2023Quote: ... ethylenediaminetetraacetic acid free protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 4-minute digestion with proteinase K (Roche, 1:1000 in PBS-DEPC) is followed by probe titration (100-300 ng per slide dependent on the probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then blocked overnight at 4°C in 1 % blocking reagent (Roche) plus 5 % sheep serum in MAB and incubated with anti-DIG conjugated to Peroxidase (1/50 ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were fixed with PFA 4 % and stained with DAPI (Roche; 1:10,000) for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 lentiviral construct along with packaging vector ΔVPR and VSVG plasmids were transfected using Fugene-6 (Roche) or PEI (POLYSCIENCES 23966-2 ...
-
bioRxiv - Cell Biology 2022Quote: ... each fatty acid was first conjugated to 10% fatty-acid-free BSA (bovine serum albumin fraction V) (#10735086001, Roche) for 1 hour at 50°C in a 50:50 volumetric ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Microbiology 2019Quote: ... frozen pellets were thawed and resuspended in 1 ml of 3 mg/ml lysozyme (Roche) and 0.4 mg/ml proteinase K (Ambion ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Neuroscience 2021Quote: ... human iPSC-derived neuronal cultures and N2a cells were collected in Lysis Buffer (50 mm Tris-Base, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid) with protease inhibitor (Roche) and phosphatase inhibitor cocktails II and III (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.18 μL Fugene 6 reagent (Roche, Basel) was added to 4.82 μL serum free medium and incubated for 5 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed in a BioRad CFX96 system employing the SYBRgreen fluorescent reagent (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... using FuGENE® 6 (Roche, Basel, Switzerland), using standard procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed using standard protocols using EvaGreenTM in the Stratagene Mx3000P system (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the RNase A (6 µg/mL, Roche) was added or not directly to the reaction mixture ...
-
bioRxiv - Microbiology 2023Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR was performed on a real-time PCR system (Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2024Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR reactions employing SYBRgreen fluorescent reagent and/or EvaGreen™ were performed in the Stratagene Mx3000P system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: 12-16 hours old embryos were collected and lysed in homogenization buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and 1 tablet of proteinase inhibitor cocktail; Roche 11836170001). The aqueous phase of the lysate was collected after 1 hour of centrifugation at 4°C and centrifuged again for 25 minutes ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from 253 resuspended vaginal swab samples using the MagNA Pure Compact Nucleic Acid Isolation Kit (Roche) [33] ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...