Labshake search
Citations for Roche :
5901 - 5950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-Digoxigenin-POD Fab fragments (1:100) (Roche, 11207733910), and Goat α-mouse Alexa 488 (1:300 ...
-
bioRxiv - Developmental Biology 2023Quote: Anti-sense probes were synthesized using the DIG and Biotin-RNA labelling kit (Roche, 11277073910 and 11685597910 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RPE explants were collected in 60 μl of lysis buffer (Tris-HCl 62.5 mM, SDS 2%, pH 6.8) with protease (Roche, #1183617001) and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic libraries were generated using Kapa Hyper library prep kit (Roche, Basel, Switzerland) and Illumina UD 96 index kit (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... and complete mini protease inhibitor cocktail (Roche). Lysates were then incubated with ALB and 1mg/ml zymolase (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... mRNA-seq libraries were constructed from 600ng of total RNA using the KAPA mRNA HyperPrep Kit (Kapa Biosystems). Three independent biological replicates were analyzed for each genotype ...
-
bioRxiv - Genetics 2023Quote: ... qPCR was performed using the Library quantification kit for Illumina (KAPA Biosystems, Basel, Switzerland) on a CFX384 Touch instrument (Bio-Rad ...
-
bioRxiv - Genetics 2023Quote: ... the mixture was incubated at 42 °C overnight and then added to 10 ml DIG-Easy hybridization solution (Roche).
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL of each primer Oligo 90 and Oligo 91 were combined with 50 ng of sample plasmid DNA and 25 µL Kapa Hifi Hotstart ReadyMix (Kapa Biosystems Cat# KK2602), and topped off with water to a total volume of 50 µL ...
-
bioRxiv - Genetics 2023Quote: ... extracted RNA was treated with RNase-free DNase I (Roche #04716728001) for 1 hour at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... 0.5 μl 10 μM primers and 12.5 μl KAPA HiFi HotStart ReadyMix (Roche, 7958927001) was used for the first round of PCR for a total volume of 25 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Digoxigenin-labelled probes were then detected by incubating with sheep Anti-Digoxigenin-POD Fab fragments (Roche) at a 1:50 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... and DIG or FITC RNA labelling mixes (Roche).
-
bioRxiv - Genomics 2023Quote: ... DNAse I (11284932001, Roche) in HBSS buffer (H6648 ...
-
bioRxiv - Genomics 2023Quote: ... Dnase I 30 μg/ml (Roche), Collagenase A 2 mg/ml (Roche ...
-
bioRxiv - Genomics 2023Quote: ... Collagenase A 2 mg/ml (Roche, 10103578001), CaCl2 5 Mm (Sigma) ...
-
bioRxiv - Genomics 2023Quote: ... samples were minced and 0.15-0.2g of the minced tissue was transferred into the digestion mix (1.07 wU/ml Liberase DH (Roche, 5401054001), (70 U/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were detected using an anti-digoxigenin antibody conjugated with alkaline phosphatase (Roche 11093274910). The zebrafish antisense RNA probes used in this study include myl7 ...
-
bioRxiv - Genetics 2023Quote: ... Mutations were generated with KAPA HiFi DNA Polymerase (KAPA Biosystems KK2601) and 40 ng of CYP2C19 template plasmid attB-CYP2C19-eGFP-IRES-mCherry ...
-
bioRxiv - Developmental Biology 2023Quote: ... tropicalis embryos was performed according to the method described by Harland [45] with BM purple (Roche).
-
bioRxiv - Genomics 2023Quote: ... resuspended in 850 μL RIPA buffer (1×PBS, 1% IGEPAL, 0.5% Sodium Deoxy-cholate, 0.1% SDS, Roche Protease Inhibitor Cocktail) and added to the beads ...
-
bioRxiv - Genomics 2023Quote: ... Final library concentration was quantified using size distribution by the Agilent 2200 Tape Station and/or qPCR using the Library Quantification Kit (KK4854, Kapa Biosystems). Equimolar amounts of each library were pooled prior to multiplex sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... 250 μL lysis buffer (4% w/v SDS and cOmplete Tablets (Roche) in 50 mM Tris-HCl ...
-
bioRxiv - Immunology 2023Quote: ... 0.2mg ml-1 Dnase I (Roche) in HBSS with calcium and magnesium ...
-
bioRxiv - Immunology 2023Quote: ... and transcribed into cDNA using Transcriptor First Strand cDNA Synthesis Kit (Roche). SYBR green master mix (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... version 2.0 (Roche Diagnostics, Germany) with a limit of detection at 20 copies/ml ...
-
bioRxiv - Immunology 2023Quote: ... euthanized mice were perfused with PBS and the left lung lobes digested for 1 h with collagenase D (1.5 mg/ml, Roche) and DNAse A (40 U/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... and subsequently incubated with 20 μL of protein G-agarose beads (Roche) or protein A-agarose beads (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... The rAAVs were titrated by quantitative PCR using LightCycler 480 SYBR Green I Master mix (Roche, Basel, Switzerland) and inverted terminal repeat primers as described75 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The aqueous layer was then transferred to a siliconized Eppendorf tube followed by the addition of 2.0 mL glycogen (Roche) and 500 mL isopropanol (Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with the KAPA SYBR® FAST qPCR Master Mix Kit (KAPA Biosystems, KR0389_S-v2.17). Expression values were normalized to the αTub84B gene (CG1913) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.1% SDS) supplemented with complete protease inhibitor cocktail (Roche) and 1 mM PMSF (Millipore Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were incubated in BM Purple (Roche) until colored reaction was observed ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified using the High Pure PCR Product Purification Kit (Roche) and quantified using the Quant-iT™ PicoGreen™ dsDNA Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymerase T7 or Sp6 (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... containing Liberase TM (Roche, 540111901, 50 μg/ml) and DNAse I (MilliporeSigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... and PhosSTOP (Roche, 4906837001). Clarified lysates (∼800 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 1U/ml Dispase (Roche; catalog no. 04942078001), Aprotinin (2µg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... Sigma Aldrich) with 10% PhosSTOP phosphatase inhibitor (Roche, NSW, Australia). The isolated cells were homogenised using a 1 ml syringe (Livingstone International ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Triton X-100) containing cOmpleteTM EDTA-free Protease Inhibitor Cocktail (Roche) and RNase Inhibitor (0.25 U/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... with added cOmplete ULTRA protease inhibitors (Roche, UK), vortexed briefly ...
-
bioRxiv - Developmental Biology 2023Quote: ... the samples were treated in 20 mg/ml Proteinase K (Roche) in PK buffer (100 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Digoxigenin-labeled RNA probe was synthesized using DIG RNA labeling kit (Roche). BZ-9000 fluorescence microscopy system (KEYENCE ...
-
bioRxiv - Genetics 2023Quote: ... the cell pellet was resuspended in 750 μl Tris lysis buffer (50 mM Tris, 0.2% NP-40, 150 mM NaCl, 5 mM EDTA, 5.7 mM PMSF, and 1 x Roche cOmplete). For whole organ samples (either whole detunicated testis or thymus) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat monoclonal anti::HA (clone 3F10, 1:200 dilution, Roche), rat monoclonal anti-dEcad (1:200 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... Positive controls were generated by incubating some sections from control 3 dpf animals with recombinant DNAse I (400 U/ml; Roche) for 20 minutes at room temperature before the incubation in the reaction mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... Resulting amplicons were used as templates for the synthesis of either digoxigenin (DIG) or fluorescein (FITC)-labelled anti-sense probes by in vitro transcription using T7 or T3 polymerases (Roche) and DIG or FITC RNA labelling mixes (Roche).
-
bioRxiv - Developmental Biology 2023Quote: ... FITC-labelled probes were detected first by incubating with sheep Anti-Fluorescein-POD Fab fragments (Roche) at a 1:50 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... using KAPA HiFi polymerase (Catalog no. KK2501, Kapa Biosystems) introducing restriction sites for XhoI (Catalog no ...