Labshake search
Citations for Roche :
5851 - 5900 of 6198 citations for Mouse Serine threonine Protein Kinase 17B STK17B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on an QuantStudio™ 6 Flex Real-Time PCR System using a SYBR green-based real-time kit (Kapa Biosystems). The RNA polymerase II subunit ama-1 was used as the house-keeping control ...
-
bioRxiv - Molecular Biology 2022Quote: ... negative and positive samples contained an equivalent volume of HBsAg-specific diluent ([HBSAGQ2 Dil HepB] from the Elecsys HBsAg II quant II immunoassay kit (Roche Diagnostics International) and were used to exclude unknown contamination within the experimental setup and laboratory environment ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... According to the manufacturer’s protocol for Southern blot hybridization and detection digoxigenin-labeled hybridization probes (DIG DNA Labeling and Detection Kit, Roche Applied Science, 11175033910) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... The cell viability following 4-AP treatment was assayed by MTT assay according to manufacturer’s protocols (Roche, cell proliferation kit I (MTT), # 11465007001) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were scraped and lysed in lysis buffer of Pierce Crosslink IP Kit (Thermo/Pierce) with complete protease inhibitor cocktail tablet (Roche Applied Sciences). Cell lysates were incubated overnight at 4°C with anti-Myc-sepharose made with anti-Myc antibody (Cell signaling ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Pathology 2022Quote: ... was isolated from either the IFP or replacement tissue that remained in formalin-fixed paraffin-embedded blocks following acquisition of adequate sections for histopathology and immunohistochemistry (IHC) using a commercially available kit specifically designed for such (Roche, Basel, Switzerland). A custom set of guinea pig-specific probes were designed and manufactured by NanoString Technologies (Seattle ...
-
bioRxiv - Pathology 2022Quote: We detected DNA fragmentation resulting from apoptotic signaling cascades with the In Situ Cell Death Detection Kit Fluorescein (Roche, 11684795910, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Final libraries were checked for quality and quantity using the Agilent TapeStation system and qPCR using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche). Sequencing was conducted in the Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Gene expression analysis via RT-qPCR was performed using a LightCycler480 instrument and LightCycler480 SYBR Green Master Kit reagents (Roche, Indiana, IN). Relative gene expression levels were determined using a standard curve method ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed as described in Han et al., 2018 (Han et al., 2018) using KAPA SYBR® FAST qPCR Kit Master Mix on LightCycler® 96 instrument (Roche). Relative expression was calculated by dividing ACTIN2 gene expression over the specific-gene expression and the fold change was calculated by dividing estradiol expression over DMSO (mock ...
-
bioRxiv - Biochemistry 2021Quote: Cell-free histone levels were assessed in plasma from healthy controls and COVID-19 patients using a photometric enzyme immunoassay (Cell Death Detection ELISAPLUS kit, Roche Applied Science) that measures histone-associated DNA fragments according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids from these 200μL mosquito pools and from 100μL venous and finger prick whole blood samples in RNAprotect Cell Reagent were isolated using the bead-based MagNAPure LC automatic extractor (Total Nucleic Acid Isolation Kit—High Performance, Roche Applied Science) and eluted in 50μL of water ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was converted to cDNA using an oligo dT primer and the Transcriptor First Strand cDNA Synthesis kit (Roche Molecular Systems). qPCR was performed using PowerUp SYBR Green (Applied Biosystems Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the LDH release in cell culture supernatant from infected cells was measured at 24 h and 96 hpi by using the colorimetric kit (Roche, Mannheim, Germany) and following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Total RNA was then provided to the Functional Genomics Laboratory at UC Berkeley where RNA-seq libraries were prepared by Oligo dT enrichment followed by a stranded Illumina library prep protocol with the KAPA mRNA HyperPrep kit (Kapa Biosystems, KK8580). Libraries were checked for quality on an AATI Fragment analyzer (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: The extent of cell death following MPP+ treatment with and without LMX1B overexpression was assessed by using the terminal deoxynucleotidyl transferase mediated dUTP-biotin nick end-labeling (TUNEL) method (In situ cell death detection kit, TMR red, Roche, Cat# 12156792910), according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2022Quote: ... Extraction of total nucleic acid was performed using the MagNA Pure 96 DNA and Viral NA Small Volume Kit in the MagNA Pure 96 system (Roche, Penzberg, Germany), and eluted in a volume of 50μl Roche Tris-HCl elution buffer ...
-
bioRxiv - Genetics 2019Quote: ... Partial f5 cDNA fragments were amplified to synthesize sense and antisense digoxin-labeled RNA riboprobes (DIG RNA labeling kit, Roche, Basel, Switzerland) (Table 1) ...
-
bioRxiv - Neuroscience 2019Quote: ... Accurate quantification of the final libraries for sequencing applications was determined using the qPCR-based KAPA Biosystems Library Quantification kit (Kapa Biosystems, Inc.). Each library was diluted to a final concentration of 12.5 nM and pooled equimolar prior to clustering ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Ki-67 was performed automatically on a Ventana Benchmark XT autostainer system with the XT ultra-View DAB Kit (Ventana Medical Systems, Roche, Basel, Switzerland). Primary antibodies were the monoclonal anti-PD-L1 antibody raised in rabbit (1:100 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...
-
bioRxiv - Zoology 2019Quote: ... In vitro transcription of DNA template was carried out using thermocycler followed by RNA probe synthesis using DIG RNA labelling kit using manufactures protocol (Roche Diagnostics, Germany). DIG labelled mRNA was synthesized and analysed using agarose gel electrophoresis and sequencing.
-
bioRxiv - Bioengineering 2019Quote: ... Hybridization and washing were performed according to the procedures of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannhein, Germany). The membranes were imaged using UVP software.
-
bioRxiv - Microbiology 2019Quote: ... The V3-V4 region of the 16S rRNA gene was PCR amplified using the KAPA HotStart PCR Kit (Kapa Biosystems, Wilmington, MA) with 10 µL Kappa HotStart Mastermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was diluted to a final concentration of 5 ng/μl and RT–qPCR was performed with KAPA SYBR® FAST qPCR kits (KAPA Biosystems) on a C1000 thermal cycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the operating procedures according to the protocol supplied by the manufacturer of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany). The prober primes are shown in supplementary (Table S3).
-
bioRxiv - Molecular Biology 2019Quote: ... Final libraries were checked for quality and quantity by TapeStation and qPCR using Kapa’s library quantification kit for Illumina Sequencing platforms (Kapa Biosystems, Wilmington MA). The samples were pooled ...
-
bioRxiv - Systems Biology 2019Quote: ... The pooled library DNA was evaluated based on the averaged length and concentration using a Bioanalyzer Agilent High-Sensitivity DNA Kit (Cat# 5067-4626) in the range of 150–3,000 bp and a KAPA library quantification kit (Cat# KK4824, Kapa Biosystems, Wilmington, MA). Finally ...
-
bioRxiv - Microbiology 2019Quote: Southern blot was performed using a digoxigenin (DIG) High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics GmbH, Mannheim, Germany) as instructed by the manufacturer ...
-
bioRxiv - Plant Biology 2020Quote: ... In situ nick-end labeling of nuclear DNA fragmentation was performed for 1 h in the dark at 37°C using the In-Situ cell death detection kit (Roche Applied Science) according to the manufacturer’s manual ...
-
bioRxiv - Genomics 2020Quote: ... Whole transcriptome libraries were constructed using the KAPA Stranded mRNA-seq library kit (Roche Sequencing and Life Science, Kapa Biosystems, Wilmington, MA) from 250ng of total input RNA with the Beckman Coulter Biomek FXP automation system (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... Blots were hybridized with a digoxygenin (DIG)-labeled ZmPEPC promoter-specific probe synthesized using primers (Fwd 5’-TCCCGAGTTCCTAACCACAG; and Rev 5’-GTGGCTGAGGCTTCTTTTTG) and the PCR DIG Probe Synthesis Kit (Roche Diagnostics, Switzerland). The signals were detected by CDP-Star (Roche Diagnostics ...
-
bioRxiv - Synthetic Biology 2020Quote: ... taiwanensis VLB120 was used as the template for the PCR and was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Plasmids were constructed by Gibson assembly using the NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Mip1α and housekeeping gene β-actin was evaluated by quantitative RT-PCR using the LightCycler 480 SYBR Green 1 Master kit and LightCycler 480 II (Roche, Indianapolis, IN) and oligos ...
-
bioRxiv - Microbiology 2019Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high-sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Microbiology 2020Quote: ... and then the pooled libraries were diluted for accurate qPCR quantification using KAPA Library Quantification Kit for Illumina platforms (KAPA Biosystems, MA). The libraries pools were adjusted to a final concentration of 11.5 pM (for V2 kits ...
-
bioRxiv - Genetics 2021Quote: ... 500 ng total RNA was used for generating strand-specific RNA-seq libraries using the KAPA Stranded RNA-Seq Kit with RiboErase (Kapa Biosystems, MA). RNA-seq libraries were sequenced on an Illumina NextSeq 500 platform with paired-end 75 bp read length.
-
bioRxiv - Immunology 2021Quote: ... 5 μl of the resulting cDNA-containing reverse transcription mixes were then used as templates for 25 μL PCR reactions using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and the following thermal cycling conditions ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 µg RNA was used for cDNA synthesis with oligo(dT)12-18 using Transcriptor first-strand synthesis kit (Roche, Basel, Switzerland). Transcript levels were measured by qRT-PCR using LightCycler 480 SYBR Green I Master (Roche ...
-
bioRxiv - Genetics 2020Quote: ... A small portion of the vitelline glands from the posterior part of each fluke was used for DNA extraction using the High Pure DNA Extraction Kit (Roche, Mannheim, Germany) following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: The bone libraries were prepared in a dedicated low copy DNA laboratory using the KAPA Hyper Prep Kit (Roche Sequencing, Wilmington, MA). Library preparation followed the manufacturer’s recommendations using 15 µM 8-bp dual-indexed adapters ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Physiology 2020Quote: ... Tissues were homogenised in assay buffer provided in the kit with the addition of 5 μL of protease inhibitor cocktail (Roche, Basel Switzerland) and centrifuged at 800 × g for 10 minutes at 4°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparation was carried out using KAPA Hyper Prep and HiFi HS Library Amplification kits (F. Hoffmann-La Roche AG, Basel, Switzerland) and with iTru i5 and i7 dual-indexing primers (BadDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Southern blotting was performed as instructed in the instruction manual for the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche Cat. 11585614910).