Labshake search
Citations for Roche :
5801 - 5850 of 6468 citations for Alpaca ZAP Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... ATAC-Seq libraries were generated from transposed DNA using the Kapa Biosystems Real-Time Library Amplification kit (Kapa Biosystems, Cat. 07959028001) according to the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... assay [31] was performed on cryosections of retinal explants using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Plant Biology 2021Quote: ... a digoxigenin-labeled probe corresponding to 415 bp of the ACMV AC1 gene was generated using a PCR DIG Probe Synthesis kit (Roche Diagnostics) and the primer pair ...
-
bioRxiv - Microbiology 2020Quote: ... The library pool was quantified with the KAPA SYBR FAST ABI Prism Library Quantification Kit (Kapa Biosystems, Inc., Woburn, MA, USA) and used for cluster generation on the cBot with the Illumina TruSeq SR Cluster Kit v3 ...
-
bioRxiv - Neuroscience 2021Quote: ... and RNA-Seq libraries were prepared from 500 ng total RNA using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems) for rRNA depletion ...
-
bioRxiv - Microbiology 2020Quote: ... The final cDNA libraries were evaluated on the BioAnalyzer and quantified using the Kapa Library Quantification Kit (Roche Sequencing, Pleasanton, CA) by Molecular Genomics Core Facility (Moffitt Cancer Center ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNA expression cassettes were amplified from gDNA in a two-step nested PCR using KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems). For PCR1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization was conducted according to the procedures described in the DIG High Prime DNA Labeling and Detection Starter kit II protocol (Roche®), using a 725-bp C-terminal TalCMAI1 amplicon as probe (Yu et al ...
-
bioRxiv - Plant Biology 2021Quote: ... The obtained library was amplified by emulsion polymerase chain reaction (PCR) using a GS FLK Titanium SV/LV emPCR Kit (Lib-L; Roche Diagnostics), added to a GS FLK Titanium PicoTiterPlate (Roche Diagnostics) ...
-
bioRxiv - Plant Biology 2020Quote: ... Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) followed by size selection from 1.5kb to 3.5kb with a BluePippin system (Sage Science ...
-
bioRxiv - Zoology 2021Quote: ... a fragment of the EHP small subunit ribosomal RNA (SSU rRNA) gene was used to generate an EHP probe with a PCR-DIG labeling kit (Roche, Germany) ENF779 and ENR779 (Tangprasittipap et al. ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR amplification was performed using the LightCycler® 480 Probes Master Kit according to the manufacturer’s recommendations (Roche Diagnostics, Meylan, France). Each well contained 10 µL of mix ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems) prior to cluster generation ...
-
bioRxiv - Pathology 2021Quote: ... The obtained individual libraries were also quantified by an Agilent 2100 Bioanalyzer using a DNA7500 LabChip kit and an equimolecular pool of libraries were titrated by quantitative PCR using the “Kapa-SYBR FAST qPCR kit for LightCycler 480” (Kapa BioSystems) and a reference standard for quantification ...
-
bioRxiv - Microbiology 2019Quote: ... and pooled for Illumina MiSeq sequencing using custom sequencing primers and the MiSeq Reagent v2 500 cycle Kit (Roche, Branford, CT) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... DNA extractions performed at the MPI-SHH substituted the column apparatus from the High Pure Viral Nucleic Acid Large Volume Kit (Roche, Switzerland) in place of the custom assembled Zymo-reservoirs coupled to MinElute (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: An antisense RNA DIG-probe was generated by transcription from linearized pCS1 vector containing Sorbs1 coding sequence using SP6 RNA polymerase kit where UTPs were labelled with digoxigenin (DIG) (Roche, 11175025910).
-
bioRxiv - Genomics 2020Quote: ... Note that all other characteristics observed for a retrotransposon insertion when using the exome capture kit from Roche (see Figure 2) are also observed when using the kit from Agilent.
-
bioRxiv - Cancer Biology 2020Quote: Approximately 500ng of FFPE RNA or 100ng of fresh frozen RNA per sample were used for RNA library construction using the KAPA RNA Hyper library prep kit (Roche, Switzerland) per the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... three-to-four 5μm FFPE samples sections were taken for RNA extraction using commercial FFPE nucleic acid isolation kit (Roche Molecular Diagnostics). RNA was quantified using Nanodrop and analyzed for fragment distribution using a bioanalyzer (Agilent) ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-sense-tiRNA DNA oligos were ordered from IDT and labelled with DIG using the DIG Oligonucleotide Tailing Kit (Roche, 03353583910). Sequences of the probes are ...
-
bioRxiv - Neuroscience 2020Quote: ... The stained cells were further labelled by TUNEL (TdT-mediated dUTP-X nick end labeling) with an In-Situ Cell Detection Kit (TMR red) from Roche (12156792910). Fluorescent images were collected on a Zeiss Automatic stage microscope with Zen blue software ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription from RNA to cDNA was performed with the Transcriptor Universal cDNA Master kit from Roche (Ref. 05893151001, lot. 32966400). The semiquantitative real-time PCR was proceeded with the faststart universal SYBR green master from Roche (Ref ...
-
bioRxiv - Cell Biology 2020Quote: ... Accurate quantification for sequencing applications was performed using qPCR-based KAPA Biosystems Library Quantification kits (Kapa Biosystems, Inc., Woburn, MA, USA). Each library was diluted to a final concentration of 1.25 nM and pooled in equimolar ratios prior to clustering.
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were prepared in an automated fashion using an Agilent Bravo robot with a KAPA Standard mRNA-Seq Kit (KAPA BIOSYSTEMS). In house adaptors were ligated to 100-300 bp fragments of dsDNA ...
-
bioRxiv - Microbiology 2022Quote: ... Final libraries were checked for quality and quantity using the Agilent TapeStation system and qPCR using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche). Sequencing was conducted in the Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 µg of purified RNA per sample was used to generate sequencing libraries following the manufacturer’s protocols of KAPA mRNA HyperPrep Kit (KK8581, Roche Life Science). The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727 ...
-
bioRxiv - Microbiology 2022Quote: ... and the concentration of the differently indexed samples determined using a KAPA Library Quantification Complete kit (Kapa Biosystems, Woburn, MA, USA). Sequencing was performed using the MiSeq Reagent Kit v3 (600 cycle) ...
-
bioRxiv - Biochemistry 2022Quote: ... This native whole cell clone was further used as a template to make the G148P mutant (MopRG148PLUC) in mopR - Pm/Pmop by employing standard ‘site-directed mutagenesis’ protocol using the “site-directed mutagenesis kit” from Kapa biosystems. The cloned MopRG148PLUC construct was then transformed into Escherichia coli DH5α cells and pre-inoculum was setup at 37°C overnight with the transformed colonies for performing the luciferase assay.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each ligated DNA was quantified by qPCR using the Kapa Library quantification kit (Kapabiosystems) on a LightCycler 480 (Roche Life Science) prior to pooling (4 ...
-
bioRxiv - Cell Biology 2022Quote: TUNEL assay was performed on N153S and WT lumbar disc tissue sections using an in situ cell death detection kit (Roche Diagnostic). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... Medium calcium content was measured by photometrical absorption measurement of calcium EDTA complex using a Calcium Gen.2 kit (Roche, Germany). After 7 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 600 ng of purified gDNA was used to construct a sequencing library using KAPA HyperPlus library preparation kit (Roche Diagnostics). Final library QC for size distribution verification was done on Caliper Lab Chip GX (Perkin Elmer ...
-
bioRxiv - Microbiology 2021Quote: ... The final concentration of the DNA library was quantified with real time PCR using the Kapa library quantification kit (Roche, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... as per the manufacturers protocol. Libraries were quantified using Qubit (Life Tech Qubit high sensitivity DNA kit Cat. #Q32854) and Kapa (Kapa Biosystems, KAPA Library Quantification Kit ...
-
bioRxiv - Neuroscience 2020Quote: ... and the final concentration was estimated by qPCR using primers shown in Supplementary Table S5 and KAPA Library Quantification Kit Illumina Platforms KK4828 (Roche #07960166001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit (Kapa Biosystems, Woburn, Massachusetts) prior to cluster generation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Poly-A enriched libraries were generated using the Illumina TruSeq Standard mRNA preparation kit and checked via the Bioanalyzer and quantitative PCR (KAPA Biosystems). Paired-end reads (100 nt ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in primary and cell line cultures was assessed using the cytotoxicity Lactate DeHydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). The culture medium was centrifuged at 500xg for 5min to pellet cell debris before used in the experiments.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Indexed libraries (that met appropriate cut-offs for both) were quantified by qRT-PCR using a commercially-available kit (KAPA Biosystems), and insert size distribution was determined using a LabChip GX or Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2020Quote: ... the PCR products digested with indicated restriction enzymes and ligated into the pBAD28 vector using the Rapid DNA Ligation Kit (Roche Diagnostics). Inserted DNA sequences were confirmed by DNA sequencing (StarSeq).
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Immunology 2019Quote: Poly-A mRNA was purified from total RNA using oligodT magnetic beads and strand-specific indexed libraries were prepared using the KAPA Stranded RNA-Seq kit followed by ten cycles of amplification using KAPA HiFi DNA polymerase (KAPA Biosystems). Libraries were quantified and pooled based on a post-PCR Agilent Bioanalyzer and 75 bp paired-end reads were generated on the Illumina HiSeq v4 following the manufacturer’s standard sequencing protocols ...
-
bioRxiv - Genomics 2020Quote: ... The fragments were treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). The prepared library was then quantified using KAPA Biosystem’s next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Cell Biology 2021Quote: ... the small fragments from the cDNA amplification are purified and the library is barcoded and amplified using PCR with the KAPA high fidelity PCR kit(KAPA Biosystems). After all libraries are ready their quality and size are measured using the bioanalyzer before being sequenced on a NEXTseq (Illumina).
-
bioRxiv - Immunology 2021Quote: ... Quality of libraries was determined via Agilent 4200 Tapestation using a High Sensitivity D1000 ScreenTape Assay kit and quantified by KAPA qPCR (KAPA BioSystems). Approximately 60–80 million paired-end 150 bp reads were generated per sample using Illumina HiSeq 4000 platform ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression was analyzed by LightCycler 480 SYBR Green Ⅰ Master kit with LightCycler 480 Detection System (Roche Diagnostics, Mannheim, Germany). qPCR values were normalized by GAPDH expression ...