Labshake search
Citations for Roche :
5801 - 5850 of 8748 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 μL of FastStart SYBR Green Master (Roche Diagnostics, Indianapolis, IN USA), 0.4 μL of qRT-PCR primers (Table S1) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Blocking was performed with 5 % Bovine serum albumin (Boehringer Mannheim, now Roche) in 1x PBST (1x PBS with 0.05 % Tween-20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5µL SYBR Green I Master mix (5 mL: Roche Diagnostics, Indianapolis, IN) and 2 µL of distilled and deionized H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 µL of 5 µM dT overhang adapter (Roche, cat. no. KK8727) was used for the End Prep reaction ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were blocked in 5% BSA (Roche, 10 735 086 001) in TBS-T before overnight incubation at 4°C with primary antibodies ...
-
bioRxiv - Genomics 2023Quote: ... and 0.08U KAPA2G Robust HotStart DNA Polymerase (5 U/mL, Roche KK5517). PCR reactions were performed using a thermocycler with the following conditions ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were blocked in blocking buffer comprised of 4% Bovine Serum Albumin (Roche, 10735087001) and 1% Triton X-100 in 1X PBS for 30 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.65% Nonidet P-40 and 1 mM phenylmethylsulfonyl fluoride) supplemented with proteinase inhibitor mixture (cOmpleteTM EDTA-free; Roche). The nuclei were harvested by scraping into a 1.5-ml microcentrifuge tube and collected by centrifugation at 500 × g for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... the membrane was first probed with an anti-GFP antibody (Cat.No. 11814460001, Roche, Basel, Switzerland; 1:3’000 dilution) followed by a secondary anti-mouse-IR800 (R-05061 ...
-
bioRxiv - Cell Biology 2020Quote: Cell suspension (1 million cells/ml) was mixed with 6x SDS loading buffer and 10 mM DTT (Roche) and incubated at 95 °C for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were incubated with the anti-HA high affinity antibody (3F10) (1:500 dilution, Roche – cat. 11867423001), followed by incubation with an anti-rat secondary antibody conjugated to Alexa Fluor 488 (1:2000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... harvested cells were incubated with 25 μg/ml digitonin in buffer H (20 mM Hepes-KOH, pH 7.4, 0.25 M sucrose, 1 mM DTT, complete protease inhibitor cocktail [Roche] ...
-
bioRxiv - Plant Biology 2021Quote: ... and incubated at room-temperature with a 1:500 dilution of anti-Dioxigenin-AP Fab fragments (Roche, #11093274910) in 1% BSA/0.3 % Triton-X100/TBS for 1hour ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from asynchronous RPE-1 cells using the High Pure RNA Isolation kit (Roche, 11828665001) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... cells were lysed in ice cold RIPA buffer (50mM Tris HCL, 150mM NaCl, 0.1% SDS, 0.5% DOC, 1%NP-40, EDTA-free protease inhibitor (Roche), phosphatase inhibitors (Halt phosphatase ...
-
bioRxiv - Genetics 2021Quote: ... livers were resuspended in a total volume of 4.687 ml of XL Buffer (50 mM Hepes, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1X Roche Complete Protease Inhibitor Cocktail ...
-
bioRxiv - Genetics 2021Quote: ... Harvested cells in lysis buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and protease inhibitor (#11873580001, Roche) in PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated in alkaline phosphatase-conjugated anti-DIG (Digoxygenin) antibody Fab fragments (1:5000; Roche, catalog #12486523) at 1:5000 in the blocking buffer and incubated at 4°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR was performed with a LightCycler® 480 SYBR Green 1 Master reaction mix (Roche Diagnostics, Mannheim, Germany), following the manufacturer’s temperature program with 60°C for the primer hybridization and elongation temperature.
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM EDTA, 300 mM NaCl, 10 mM Tris.HCl [pH 8.0], 1 mM EDTA, 1x Complete protease inhibitor [Roche] ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM MgCl2, 10 % v/v glycerol, 140 mM NaCl, 0.1 mM EDTA, 0.5 % Tween20, 1 mM DTT and Roche cOmplete-Ultra EDTA free protease inhibitor) ...