Labshake search
Citations for Roche :
5551 - 5600 of 6198 citations for Mouse Serine threonine Protein Kinase 17B STK17B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and pooled for Illumina MiSeq sequencing using custom sequencing primers and the MiSeq Reagent v2 500 cycle Kit (Roche, Branford, CT) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... DNA extractions performed at the MPI-SHH substituted the column apparatus from the High Pure Viral Nucleic Acid Large Volume Kit (Roche, Switzerland) in place of the custom assembled Zymo-reservoirs coupled to MinElute (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: An antisense RNA DIG-probe was generated by transcription from linearized pCS1 vector containing Sorbs1 coding sequence using SP6 RNA polymerase kit where UTPs were labelled with digoxigenin (DIG) (Roche, 11175025910).
-
bioRxiv - Genomics 2020Quote: ... Note that all other characteristics observed for a retrotransposon insertion when using the exome capture kit from Roche (see Figure 2) are also observed when using the kit from Agilent.
-
bioRxiv - Cancer Biology 2020Quote: Approximately 500ng of FFPE RNA or 100ng of fresh frozen RNA per sample were used for RNA library construction using the KAPA RNA Hyper library prep kit (Roche, Switzerland) per the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... three-to-four 5μm FFPE samples sections were taken for RNA extraction using commercial FFPE nucleic acid isolation kit (Roche Molecular Diagnostics). RNA was quantified using Nanodrop and analyzed for fragment distribution using a bioanalyzer (Agilent) ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-sense-tiRNA DNA oligos were ordered from IDT and labelled with DIG using the DIG Oligonucleotide Tailing Kit (Roche, 03353583910). Sequences of the probes are ...
-
bioRxiv - Neuroscience 2020Quote: ... The stained cells were further labelled by TUNEL (TdT-mediated dUTP-X nick end labeling) with an In-Situ Cell Detection Kit (TMR red) from Roche (12156792910). Fluorescent images were collected on a Zeiss Automatic stage microscope with Zen blue software ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription from RNA to cDNA was performed with the Transcriptor Universal cDNA Master kit from Roche (Ref. 05893151001, lot. 32966400). The semiquantitative real-time PCR was proceeded with the faststart universal SYBR green master from Roche (Ref ...
-
bioRxiv - Cell Biology 2020Quote: ... Accurate quantification for sequencing applications was performed using qPCR-based KAPA Biosystems Library Quantification kits (Kapa Biosystems, Inc., Woburn, MA, USA). Each library was diluted to a final concentration of 1.25 nM and pooled in equimolar ratios prior to clustering.
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were prepared in an automated fashion using an Agilent Bravo robot with a KAPA Standard mRNA-Seq Kit (KAPA BIOSYSTEMS). In house adaptors were ligated to 100-300 bp fragments of dsDNA ...
-
bioRxiv - Microbiology 2022Quote: ... Final libraries were checked for quality and quantity using the Agilent TapeStation system and qPCR using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche). Sequencing was conducted in the Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 µg of purified RNA per sample was used to generate sequencing libraries following the manufacturer’s protocols of KAPA mRNA HyperPrep Kit (KK8581, Roche Life Science). The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727 ...
-
bioRxiv - Microbiology 2022Quote: ... and the concentration of the differently indexed samples determined using a KAPA Library Quantification Complete kit (Kapa Biosystems, Woburn, MA, USA). Sequencing was performed using the MiSeq Reagent Kit v3 (600 cycle) ...
-
bioRxiv - Biochemistry 2022Quote: ... This native whole cell clone was further used as a template to make the G148P mutant (MopRG148PLUC) in mopR - Pm/Pmop by employing standard ‘site-directed mutagenesis’ protocol using the “site-directed mutagenesis kit” from Kapa biosystems. The cloned MopRG148PLUC construct was then transformed into Escherichia coli DH5α cells and pre-inoculum was setup at 37°C overnight with the transformed colonies for performing the luciferase assay.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each ligated DNA was quantified by qPCR using the Kapa Library quantification kit (Kapabiosystems) on a LightCycler 480 (Roche Life Science) prior to pooling (4 ...
-
bioRxiv - Cell Biology 2022Quote: TUNEL assay was performed on N153S and WT lumbar disc tissue sections using an in situ cell death detection kit (Roche Diagnostic). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... Medium calcium content was measured by photometrical absorption measurement of calcium EDTA complex using a Calcium Gen.2 kit (Roche, Germany). After 7 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 600 ng of purified gDNA was used to construct a sequencing library using KAPA HyperPlus library preparation kit (Roche Diagnostics). Final library QC for size distribution verification was done on Caliper Lab Chip GX (Perkin Elmer ...
-
bioRxiv - Microbiology 2021Quote: ... The final concentration of the DNA library was quantified with real time PCR using the Kapa library quantification kit (Roche, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... as per the manufacturers protocol. Libraries were quantified using Qubit (Life Tech Qubit high sensitivity DNA kit Cat. #Q32854) and Kapa (Kapa Biosystems, KAPA Library Quantification Kit ...
-
bioRxiv - Neuroscience 2020Quote: ... and the final concentration was estimated by qPCR using primers shown in Supplementary Table S5 and KAPA Library Quantification Kit Illumina Platforms KK4828 (Roche #07960166001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit (Kapa Biosystems, Woburn, Massachusetts) prior to cluster generation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Poly-A enriched libraries were generated using the Illumina TruSeq Standard mRNA preparation kit and checked via the Bioanalyzer and quantitative PCR (KAPA Biosystems). Paired-end reads (100 nt ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in primary and cell line cultures was assessed using the cytotoxicity Lactate DeHydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). The culture medium was centrifuged at 500xg for 5min to pellet cell debris before used in the experiments.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Indexed libraries (that met appropriate cut-offs for both) were quantified by qRT-PCR using a commercially-available kit (KAPA Biosystems), and insert size distribution was determined using a LabChip GX or Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2020Quote: ... the PCR products digested with indicated restriction enzymes and ligated into the pBAD28 vector using the Rapid DNA Ligation Kit (Roche Diagnostics). Inserted DNA sequences were confirmed by DNA sequencing (StarSeq).
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Immunology 2019Quote: Poly-A mRNA was purified from total RNA using oligodT magnetic beads and strand-specific indexed libraries were prepared using the KAPA Stranded RNA-Seq kit followed by ten cycles of amplification using KAPA HiFi DNA polymerase (KAPA Biosystems). Libraries were quantified and pooled based on a post-PCR Agilent Bioanalyzer and 75 bp paired-end reads were generated on the Illumina HiSeq v4 following the manufacturer’s standard sequencing protocols ...
-
bioRxiv - Genomics 2020Quote: ... The fragments were treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). The prepared library was then quantified using KAPA Biosystem’s next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Cell Biology 2021Quote: ... the small fragments from the cDNA amplification are purified and the library is barcoded and amplified using PCR with the KAPA high fidelity PCR kit(KAPA Biosystems). After all libraries are ready their quality and size are measured using the bioanalyzer before being sequenced on a NEXTseq (Illumina).
-
bioRxiv - Immunology 2021Quote: ... Quality of libraries was determined via Agilent 4200 Tapestation using a High Sensitivity D1000 ScreenTape Assay kit and quantified by KAPA qPCR (KAPA BioSystems). Approximately 60–80 million paired-end 150 bp reads were generated per sample using Illumina HiSeq 4000 platform ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression was analyzed by LightCycler 480 SYBR Green Ⅰ Master kit with LightCycler 480 Detection System (Roche Diagnostics, Mannheim, Germany). qPCR values were normalized by GAPDH expression ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The fragments were treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). Additionally ...
-
bioRxiv - Genetics 2022Quote: ... Libraries are validated on a Bioanalyzer DNA High Sensitivity chip to check for size and absence of primer dimers and quantified by qPCR using Kapa Library Quantification Illumina/ABI Prism Kit protocol (KAPA Biosystems). Validated libraries were paired-end sequenced on an Illumina HiSeq X platform following Illumina’s recommended protocol to generate paired-end reads of 150-bases in length.
-
bioRxiv - Genetics 2022Quote: ... Hybridization was performed as described in the Instruction Manual of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics). Washing conditions was performed according to Huang et al (Huang et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100ng of total RNA were then sent to the Harvard University Bauer Core Facility for library preparation with the Kapa mRNA Library Prep kit (Roche, Basel). Generated RNA-seq libraries were then sequenced on a single sequencing lane of the Illumina NextSeq 500 using 2×38bp reads at the Harvard University Bauer Core Facility – see Table S1 for per-sample sequencing information ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems). Cluster generation was performed according to the manufacturer’s recommendations for onboard clustering (Illumina) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Strand-specific polyA-enriched libraries were prepared using the Kapa mRNA-seq Hyper kit (Kapa Biosystems, Cape Town, South Africa KK8581). Untreated samples were sequenced on an Illumina HiSeq4000 with 1×100bp reads ...
-
bioRxiv - Microbiology 2019Quote: ... The probe was amplified by PCR with digoxigenin-dUTP from the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics), using the glms sequence as a template ...
-
bioRxiv - Genomics 2019Quote: ... DNA sequencing libraries for each of the fifteen Zinfandel clones were prepared using the Kapa LTP library prep kit (Kapa Biosystems) as described by Jones et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... For quantitative-RT PCR analysis 1 µg of total RNA of each sample was reversed-transcribed to cDNA (Transcriptor First Strand cDNA Synthesis kit, Roche 04379012001), cDNA was diluted 1:20 and used as template for amplification reactions ...
-
bioRxiv - Clinical Trials 2019Quote: ... Tagmented DNA was ligated to unique i5/i7 barcoded primer combinations using the Illumina Nextera XT Index Kit v2 and KAPA HiFi HotStart ReadyMix (2X) (KAPA Biosystems), and then purified using AmPure Beads XP (Agencourt) ...
-
bioRxiv - Microbiology 2019Quote: ... and Southern hybridization with blaKPC and rep IncFIIK DIG-labelled probes (16) prepared using published primers (35,36) and the PCR DIG Probe Synthesis Kit (Roche, Mannheim, Germany) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Libraries were quantified using a Tapestation DNA 1000 Screen Tape and by qPCR using an NGS Library Quantification Kit (KAPA Biosystems) on an AriaMx qPCR system (Agilent ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Enrichment success and size-adjusted DNA concentrations of pools were assessed using the SYBR FAST qPCR kit (Kapa Biosystems, Wilmington, MA) and all pools were combined into an equimolar final pool ...
-
bioRxiv - Genetics 2019Quote: ... Digoxigenin-labeled sense and antisense probes were synthesized using linearized pGEM-Teasy vector subcloned with this thoc1 fragment by in vitro transcription with DIG-RNA labeling Kit (Roche, Switzerland). Zebrafish embryos and larvae were collected and fixed with 4% paraformaldehyde (PFA ...