Labshake search
Citations for Roche :
501 - 550 of 6394 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... resuspendend in 10 ml of PBS buffer with 5 μg/ml DNaseI (from bovine pancreas, Roche) and 10 μg/ml lysostaphin and incubated for 20 min at 37°C to allow cell lysis ...
-
bioRxiv - Molecular Biology 2019Quote: ... washed once with ice cold Phy Buffer (150 mM Potassium Acetate, 5 mM Magnesium Acetate, 20 mM HEPES-KOH pH 7.4, 5 mM DTT, protease inhibitor cocktail [Roche], 10 µg/mL cycloheximide). Cell pellets were then re-suspended in 1 mL Phy Buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... 5% glycerol) containing 100 mM Phenylmethylsulphonylfluoride (PMSF) and EDTA-free Protease inhibitor cocktail tablets (Roche). Resuspended cells were first treated with 1 mg/ml Lysozyme to digest the cell wall and subsequently frozen at −80°C overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...
-
bioRxiv - Immunology 2020Quote: ... Cytokines were added at the following concentrations: GM-CSF (5 ng/mL, Roche), TNF (10 ng/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.6 with KOH) containing 5 mg ml−1 collagenase (type A, ROCHE). Defolliculated oocytes were injected with 50 ng mRNAs of mixed GlyT1 ...
-
bioRxiv - Immunology 2024Quote: ... Cell nuclei were stained with 5 µg/ml of DAPI (10236276001, Roche Diagnostics).
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.5% Triton X-100, 100 mM NaF, 1 mM ortho-vanadate, 2 mM EDTA, and a protease inhibitor cocktail [Roche 11836153001]). Lysates were vortexed and cleared by centrifugation (15,000 x g for 15 min at 4°C) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...
-
bioRxiv - Systems Biology 2019Quote: ... 25ml of pre-warmed to 37°C EGTA buffer followed by 25ml of pre-warmed to 37°C EBS buffer with 2.3U of Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) were cannulated into the vena cava ...