Labshake search
Citations for Roche :
501 - 550 of 2448 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... rat monoclonal anti-HA antibody (Roche);) ...
-
bioRxiv - Plant Biology 2024Quote: ... High Affinity (3F10) monoclonal antibodies (Roche).
-
Decreased Astrocytic CCL5 by MiR-324-5p Ameliorates Ischemic Stroke Injury via CCR5/ERK/CREB PathwaybioRxiv - Neuroscience 2024Quote: ... 2 μg/μl CCL5 antibody (Roche), or 20 ng/μl recombinant mouse CCL5 (Absin) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 120 µg of HA antibody (Roche) was used per 30 dishes and the 50 ml Falcons left rotating and incubating overnight in the cold room at 4 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or HA antibody (Roche, Indianapolis, IN). Anti-mouse secondary antibodies conjugated to IRDye-800 or IRDye-680 were used to detect primary GFP or mNG antibodies on an Odyssey CLx infrared imaging system (LI-COR Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-HA antibody from Roche was used at a dilution of 1:25 ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-HA antibody from Roche was used at a dilution of 1:200 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibody Anti-HA (11867423001, Roche) and secondary antibody anti-mouse HRP-labelled (A5278 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used for IFA were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:200) (Roche); mouse anti-PMV mAb (1:50) ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoblot with the anti-His-antibody conjugated to peroxidase (BMG-His-1 monoclonal antibody; Roche, Basel, Switzerland) was used to confirm the presence of enzymes.
-
bioRxiv - Cell Biology 2020Quote: The primary antibodies used in this study were as follows: mouse anti-HA antibody (Roche Life Science), mouse anti-PGK1 monoclonal antibody (Thermo Fisher/Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: Western blots were performed using the following antibodies: anti-myc antibody (Roche 0.4 mg/ml, 1/1000) followed by incubation with goat anti mouse HRP (BioRad 1/10000) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the antibody incubation was performed with 1:5000 diluted Anti-Dig-AP antibody (Roche, Cat. No. 11093274910) at 4°C overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1 hour antibody incubation (α-GFP, monoclonal mouse antibody, Roche, catalog no. 11814460001, 1:1000). After three washes with TBST for 10 min each ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Cell Biology 2020Quote: ... and protein was eluted by cleaving with 20 U/ml thrombin (Roche) in TCB (50 mM Tris ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... resuspended in protein resuspension buffer (2% SDS, 10 mM NaF, 1x Roche cOmplete Mini proteinase inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... Soluble protein was purified using batch/gravity-flow affinity chromatography (cOmplete, Roche). MED1 (50-660 ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... proteins were visualized using the lumi-light plus western blotting substrate (Roche).
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were immunologically detected by using anti-HA (3F10)-HRP (Roche, Switzerland) or anti-Myc-tag (HRP-DirecT ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected with Anti-c-myc-Peroxidase (Roche #11814150001) at dilution of 1:5,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the proteins were transferred onto a PVDF membrane (Roche Diagnostics, Mannheim, Germany). Cofilin1 and phospho-Cofilin1 (Ser3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were lysed and sonicated in RIPA buffer with protein inhibitors (Roche). Protein concentrations were estimated by BCA assay (Thermo Fisher Scientific ...