Labshake search
Citations for Roche :
501 - 550 of 616 citations for FGH Esterase D Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: Lungs harvested and cut into small pieces were digested (1h, 37c) with 4 mg/ml collagenase D (Roche, Mannheim, Germany). Tissue was meshed through a 40-µm cell strainer ...
-
bioRxiv - Microbiology 2019Quote: ... cellular pellets were suspended in 10 mL of Buffer 1X supplemented with 2 mM (L+D) 1,4-Dithiothreitol (DTT) and cOmplete™ mini protease inhibitor cocktail (Roche). To avoid overheating and protein denaturation ...
-
bioRxiv - Immunology 2021Quote: ... the dura mater was carefully removed from the brain and then chopped for enzymatic digestion in Hanks’ Balanced Salt Solution (HBSS) containing 15 mg/mL collagenase D (Roche) and 1 mg/mL DNase (Roche ...
-
bioRxiv - Physiology 2020Quote: 1 μg RNA was reverse transcribed into cDNA with Oligo(d)T primers using the Transcriptor First Strand cDNA Synthesis kit (Roche). The qRT-PCR was performed with the LightCycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science ...
-
bioRxiv - Immunology 2020Quote: ... Spleens were digested for 30 min at 37°C in digestion buffer [(RPMI 1640 supplemented 0.5 mg/ml collagenase D (Roche; 11088866001) and 10 µg/ml DNase I (Roche ...
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...
-
bioRxiv - Immunology 2022Quote: Excised tumors were cut into small pieces following by incubation 0.5 mg/ml collagenase D (Hoffmann-La Roche, Basel, Switzerland), 10 µg/ml DNAse I (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: Spleen from C57BL/6J mice were mechanically disrupted using the back-end of a syringe before addition of 50 μL 11x concentrated collagenase D (Roche, #11088866001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... dissociated with an equal mixture of 4 mg/ml of collagenase D and dispase II (Roche Applied Science, Indianapolis, IN) and cultured in F-12K (Corning ...
-
bioRxiv - Immunology 2023Quote: ... in a plate and mechanically disrupted using the back-end of a syringe before addition of 50 μL of a digestion media (dRPMI = naRPMI supplemented with 11x collagenase D (#11088866001, Roche, Woerden ...
-
bioRxiv - Microbiology 2022Quote: Lungs were perfused with sterile PBS and digested at 37°C for 1 h with 625 μg/mL collagenase D (Roche) and 75 U/mL DNase I (Sigma) ...
-
bioRxiv - Immunology 2023Quote: Spleens were injected with HBSS (with Ca2+ and Mg2+) containing 1 mg/mL of collagenase D and 10 μg/mL of DNase I (Roche) and incubated for 20 minutes at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Immunology 2023Quote: ... Kidneys were homogenized using the Miltenyi gentleMACS Dissociator and digested for 20 minutes at 37°C in RPMI with 2 mg/mL collagenase D (Roche) and 0.1 mg/mL DNAse I ...
-
bioRxiv - Immunology 2023Quote: ... lung and liver tissues were mechanically disrupted into small pieces and enzymatically digested in 2ml of digestion buffer (1 mg Collagenase D (Roche) and 0.2 mg DNase I (Roche ...
-
bioRxiv - Immunology 2023Quote: Lungs were perfused with sterile PBS and the left lobes of the lungs were digested at 37°C with 630 µg/ml collagenase D (Roche) and 75 U/ml DNase I (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 mL dissociation buffer (RPMI-1640 (Cytiva) with 25 mM HEPES and 10 µg/mL gentamicin sulfate) supplemented with 2 mg/mL Collagenase-D (Roche) and 100 U DNaseI (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Immunology 2021Quote: Single-cell suspensions of tumors were generated by dicing tumors with a razor blade followed by enzymatic digestion for 30 minutes at 37C in medium containing 1 mg/mL Collagenase D (Roche Diagnostics) and 1μg/mL DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 1 mM Na3VO4 and complete mini EDTA-free proteases inhibitor cocktail [Roche Diagnostics]) with Lysing Matrix D ceramic beads (MP Biomedical) using a MagNA Lyser (Roche Diagnostics) at 5,500 rpm for 20 seconds ...
-
bioRxiv - Genomics 2020Quote: ... This was followed with primary antibody incubation performed with 1:1000 goat anti-SOX17 (R&D) diluted with Antibody Dilution Buffer (Roche Ventana) for 60 minutes at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche], 2 U/mL DNase I [Life Technologies] and Dispase II [Roche]). The digested brain parenchyma ...
-
bioRxiv - Microbiology 2021Quote: ... samples were enzymatically analyzed using a D-Lactic Acid/L-Lactic Acid Enzymatic Bioanalysis UV-Test kit and a D-Glucose Enzymatic Bioanalysis UV-Test kit (Roche Diagnostics) with a modified manufacturer’s protocol to reduce total sample size to 300 uL ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... and were enzymatically digested in a shaker incubator at 37°C for 40 minutes in RPMI medium containing 1 mg/ml Collagenase D (Roche-Diagnostics), 1 mg/ml hyaluronidase and 50 U/ml DNase I (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Skin biopsy specimens were collected and minced before digestion in 1mL of DMEM with 1 mg/ mL collagenase D (Roche Diagnostics) for 3 hours at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were finely minced and digested for 40 min at 37°C with 0.4 mg/ml collagenase D (Roche, Mannheim, Germany) and 0.01 mg/ml DNase I (Roche) ...
-
bioRxiv - Immunology 2022Quote: Skin biopsies were collected and minced with sterile scissors before digestion in 1 mL of DMEM with 1 mg/mL collagenase D (Roche Diagnostics) for 3 hours at 37℃ ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 ml of digestion buffer containing collagenase D (2mg/ml, Roche #11088858001) and DNase (0.125 mg/ml ...
-
bioRxiv - Immunology 2022Quote: ... these tissues were dissected and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... the pellet was resuspended in 200 µl cold buffer D (50 mM Tris/HCl (pH=8.0), 10 mM EDTA, 1% SDS, 1xPIC (cOmplete™, Protease Inhibitor Cocktail (Roche; 04693116001)) per 15 cm plate ...
-
bioRxiv - Pathology 2023Quote: ... and kidneys were minced into small pieces and placed into 5mL digestion buffer (15mg/mL Collagenase D (Roche Applied Science, 11088858001), 10mg/mL Collagenase Type 4 (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the pellet was resuspended in 200 µL of cold buffer D (50 mM Tris/HCl, pH = 8.0, 10 mM EDTA, 1% SDS 1xPIC (cOmplete™, Protease Inhibitor Cocktail; Roche; 04693116001)) per 15 cm plate ...
-
bioRxiv - Immunology 2023Quote: ... and digested at 37°C for an hour with mechanical disruption with a stir bar and enzymatic digestion with collagenase D (Roche 11088875103) and DNase I (Sigma D4527) ...
-
bioRxiv - Immunology 2023Quote: ... in HBSS for 20 min and then incubated for 20 min with and equal volume of DMEM with Collagenase D (Roche, #11088858001) and DNase I (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... cut to very small pieces using a scalpel blade and digested using Collagenase D (Roche, Cat No. 11088858001, 1 mg/ml) /DNase I (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...