Labshake search
Citations for Roche :
501 - 550 of 2872 citations for 7 Bromo 6 chloro 3 3 3 hydroxy 2 piperidyl 2 oxopropyl quinazolin 4 3H one monohydrobromide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The dry contents were resuspended by addition of 7.5 µl hybridization buffer and 3 µl hybridization component A (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), mixed by tapping ...
-
bioRxiv - Genetics 2019Quote: BAL was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml PBS with 0.1% BSA and protease inhibitor cocktail tablets (Roche, Indianapolis, IN). Animals were then perfused with PBS before tissue collection ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 pmol of the forward and reverse gene-specific primers each (Supplemental Table 3) in Light Cycler SYBR Green I Master mix (Roche) on LightCycler 480 II (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time quantitative PCR reactions from 8,3 ng of cDNA were set up in triplicate using a LightCycler DNA SYBR Green I Master PCR machine (Roche). The oligonucleotides used in qRT-PCR experiments are provided in SI6.
-
bioRxiv - Developmental Biology 2021Quote: Genomic DNA was extracted from 3 week old tail or ear biopsies using KAPA Mouse DNA Extraction Kit (KAPA Biosystems) or High Pure PCR Template Kit (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 2.5 mL of Sf9 cells at a density of 1.2×106 cells/mL were transfected with 5 µL of recombinant bacmid containing the gene of interest using 3 µL of X-tremeGENE HP DNA transfection reagent (Roche) and 100 µL of transfection medium (Expression Systems) ...
-
bioRxiv - Biophysics 2019Quote: ... The central fragment of the molecule is flanked by oligonucleotides labelled either with digoxigenin (3’ end) or biotin (5’ end) that specifically bind either to a glass surface covered with Anti-digoxigenin (Roche) or to superparamagnetic beads (MyOne ...
-
bioRxiv - Immunology 2020Quote: ... or S-Fusion + N-ETSD constructs were cultured and transfected as described in the main manuscript and harvested 3 days after transfection in 150 mL RIPA lysis buffer with 1X final Protease Inhibitor cocktail (Roche). After protein assay ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... Cyclophilin B (control) and PPARγ siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were washed 3 times with 10 ml of ice-cold PBS supplemented with Complete Protease Inhibitor (Roche, Basel, Switzerland) and cells were resuspended in 1 ml of ice-cold PBS supplemented with Complete Protease Inhibitor ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.05% Tween 20) before exchange of the pre-incubation solution for hybridization buffer containing 3 ng/µl of digoxigenin-labeled (Roche) riboprobe ...
-
bioRxiv - Cell Biology 2022Quote: Whole endothelial extracts were prepared from 70-80% confluent cells in lysis buffer (3% SDS, 60 mM sucrose, 65 mM Tris (pH 6.8) containing protease inhibitor cocktail (Roche-11836170001). Protein extracts were sonicated briefly and the concentration of the isolated proteins was assessed using BCA Protein Assay Reagent (Thermo Scientific™ ...
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... The antisense RNA probes corresponding to the 3’ s-end portion of glnA CDS were prepared by the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... derived from SlARF2A and SlARF2B promoter was labeled with digoxigenin as per the manufacturer’s protocol using DIG Oligonucleotide 3′-End Labeling Kit (Roche Diagnostics). The same unlabeled DNA fragment was used as a competitor ...
-
bioRxiv - Plant Biology 2022Quote: ... derived from SlGLYI4 promoter was labelled with digoxigenin as per the manufacturer’s protocol using DIG Oligonucleotide 3′- End Labelling Kit (Roche Diagnostics). The same unlabelled DNA fragment was used as a competitor ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indexes and Illumina cluster generation sequences were then added with a secondary PCR reaction using 3 μL of the diluted primary PCR product with a 10 μL Kapa Robust HotStart polymerase reaction (Roche) for 20 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 1:3 in ddH2O on ice in a 45 μL total volume before analysis in the Cobas c111 Analyzer (Roche). The Cobas c111 Analyzer is a platform for clinical chemistry testing of human samples but it can also be used to analyze mouse samples ...
-
bioRxiv - Microbiology 2023Quote: Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in Table 3 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC226 using KpnI and SacI restriction sites and T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: 100 pmol gapmers (Supplemental Table S4) were labeled with biotin-16-ddUTP (Jena) and a 2nd generation DIG-oligonucleotide 3’end-labeling kit (Roche) using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MRTX849 for 3 hours prior to protein isolation with RIPA buffer containing 1x cOmpleted EDTA free protease inhibitor (Roche) and 1x phosSTOP (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... Each cDNA sample was measured in duplicate using 3 μL of 4x diluted cDNA per 10 μL reaction in a LightCycler96 Instrument (Roche). qPCR parameters were set to 10 minutes of preincubation at 95 °C ...
-
bioRxiv - Microbiology 2023Quote: Brains of ICR mice mock- infected or infected ocularly with 3×106 PFU/eye of vUNG-S302A and vUNG-SA-repair were homogenized in TriPure isolation reagent (Roche) using a disposable pestle system (Fisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted 1:10 in water and qPCR was performed with 3 μL of each diluted cell lysate using the LightCycler 480 Probes Master mix (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Positive controls were generated by incubating some sections from control 3 dpf animals with recombinant DNAse I (400 U/ml; Roche) for 20 minutes at room temperature before the incubation in the reaction mix ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Developmental Biology 2023Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Bioengineering 2024Quote: All qPCR reactions were carried out using 384-well plates in 3 technical replicates in 10 µl final reaction volume on the LightCycler 480 System II (Roche). Reaction mix consisted of Power Track SYBR Green Master Mix 2X ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Developmental Biology 2024Quote: Primary tissue samples from reduction mammoplasties of healthy women were dissociated through a 3 mg/mL collagenase (Roche Life Science) solution and sorted via density gradient ...
-
bioRxiv - Immunology 2023Quote: Single cell suspensions of whole lungs were lysed with Laemmli buffer (10% glycerol, 3% SDS, 10 mM Na2HPO4) with protease inhibitor cocktail (Roche). Proteins were separated on a 12% SDS-PAGE gel and electro transferred onto PVDF membranes ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Immunology 2021Quote: ... S1 protein and CP15 were formulated in nanoparticles in PLGA (Alchem Laboratories) for the first 2 doses and the last (one-year) boost was in DOTAP (100 μl per dose; Roche). For immunization ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...