Labshake search
Citations for Roche :
501 - 550 of 8155 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... One tablet of EDTA-free protease inhibitor (Roche) was added just before use ...
-
bioRxiv - Cancer Biology 2023Quote: ... One tablet of 1x cOmplete protease inhibitor (Roche) was added to 10 mL of fresh lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... Titan One Step RT-PCR kit (Roche Diagnostics) was used to check the actual infection status of dengue virus using the primers targeting the capsid pre-membrane membrane region (Lanciotti et al. ...
-
bioRxiv - Genomics 2024Quote: ... and one EDTA-free protease inhibitor tablet (Roche) per liter of culture) ...
-
bioRxiv - Immunology 2024Quote: ... beads and lysis buffer (20 mM Tris pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 0.5% sodium deoxycholate, 1× protease inhibitor cocktail [Roche])) ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were resuspended in 450 μl lysis buffer (20 mM Tris pH 7.5, 0.5 mM EDTA pH 8, 200 mM NaCl, 10% glycerol, 1 mM PMSF, 10 mM NEM, Roche cOmplete protease inhibitor catalog # 11836153001) ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1 × protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 μl/10 mg) ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were harvested at indicated time points with RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche: cOmplete mini EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Cancer Biology 2023Quote: ... tissue slides were heat pre-treated using a Cell Conditioning Buffer 1 (pH 8) (Roche Diagnostic, Meylan, France) at 98°C ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5% glycerol and 1 mM TCEP) and for final concentration of 0.5 mM and one complete protease inhibitor tab (Roche) was added ...
-
bioRxiv - Neuroscience 2019Quote: ... one series of frozen brain slices was homogenized in 1 ml PBS containing complete protease inhibitor (Roche Applied Science) and 1 mM AEBSF (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.1% Triton X-100 supplemented with 1 mM PMSF and one Complete Protease Inhibitor tablet (EDTA-free; Roche), and then centrifuged at 13,000 × g for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM ß-glycerophosphate, 5 mM NaF, 1 mM Na3VO4) and protease inhibitors (Roche cOmplete ULTRA Tablets, EDTA-free). The lysates were sonicated on ice (4x 10s bursts ...
-
bioRxiv - Immunology 2022Quote: Skin biopsies were collected and minced with sterile scissors before digestion in 1 mL of DMEM with 1 mg/mL collagenase D (Roche Diagnostics) for 3 hours at 37℃ ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0,08% Collagenase D (Roche, 11088882001) and 10μg/ml of DNAse I (04536282001 ...
-
bioRxiv - Immunology 2019Quote: ... 1.25mg/ml Collagenase D (Roche), 1mg/ml Dispase (Gibco ...
-
bioRxiv - Genomics 2021Quote: ... 400U of Collagenase D (Roche) were then added to the mixture ...
-
bioRxiv - Immunology 2023Quote: Collagenase D (Roche, Indianapolis, IN) was added at 2 mg/mL and the sample was shaken at 37 °C degrees at 150 rpm for 40 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1mg/ml collagenase D (Roche) and 25µg/ml DNase 1 (THermo Fisher Scientific)) ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.525mg/ml collagenase D (Roche), 5 unit/ml Dispase (Stemcell Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Genetics 2020Quote: ... 0.1 M ammonium bicarbonate, pH 8, 150 mM NaCl, 1 Roche mini protease inhibitor tablet without EDTA/10 ml, ½ Roche phosSTOP tablet/10 ml) using 14 × 1.5 min bursts on a BioSpec mini bead-beater at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche). Insoluble debris was removed by centrifugation at 15000 rpm for 30 min ...
-
bioRxiv - Physiology 2022Quote: ... the spleen was additionally digested in HBSS medium containing 1 mg/ml Collagenase D (Roche, 11088882001) and 50 U/ml DNase I for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% n-dodecyl β-D-maltoside [DDM] and 1X cOmplete™ EDTA-free protease inhibitor (Roche)) and incubated at 4°C for 30 mins ...
-
bioRxiv - Immunology 2022Quote: ... disrupted in 10 ml of RPMI (1%FBS) in the presence of Collagenase D (1X) (Roche) using a MACs dissociator (Miltenyi Biotec ...
-
bioRxiv - Molecular Biology 2019Quote: ... The tissue fragments were digested in DMEM medium containing 1 mg/mL Collagenase D (Roche, Switzerland), 1 mg/mL Collagenase/Dispase (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... skeletal muscle tissue was enzymatically digested with 1.5 U mL−1 collagenase D (Roche, Ref. 11088882001), 2.4 U mL−1 dispase II (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Tumor draining lymph nodes (tdLNs) were minced and digested with Collagenase D (1 mg/mL, Roche) and DNAse I (50 μg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... It was then minced and digested in HBSS containing 10 mg ml-1 Collagenase D (Roche), 3 U ml-1 Dispase II (Roche) ...
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: ... Left lung lobes were dissociated by enzymatic digestion with 1 mg/mL collagenase D (Roche, 11088882001), and 1 mg/mL collagenase IV (Worthington Biochemical ...
-
bioRxiv - Immunology 2023Quote: ... kidneys were then incubated for 15 minutes in DMEM containing 1 mg/ml Collagenase D (Roche), 100U/ml DNAse I (Sigma) ...