Labshake search
Citations for Roche :
501 - 550 of 6880 citations for 4 Methoxy 2 3 3 4 5 Pentacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Positive controls were generated by incubating some sections from control 3 dpf animals with recombinant DNAse I (400 U/ml; Roche) for 20 minutes at room temperature before the incubation in the reaction mix ...
-
bioRxiv - Developmental Biology 2024Quote: Primary tissue samples from reduction mammoplasties of healthy women were dissociated through a 3 mg/mL collagenase (Roche Life Science) solution and sorted via density gradient ...
-
bioRxiv - Microbiology 2022Quote: ... and the right inferior lung lobes were digested in 50 μL of 5 mg/mL of Liberase Tm (Roche) and 12.5 μL of 10 mg/mL of DNase I (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... then the pellet was resuspended in 40 ml binding buffer (50 mM NaPi, 300 mM NaCl, 5 mM imidazole, pH 7.5) containing protease inhibitor (Roche cOmplete EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2021Quote: ... and Biotin-16-dUTP (Roche Diagnostics, 4 μm) and added to slides for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg anti-HA antibody (Roche Sigma 11867423001) was used for immunoprecipitation with BioVision immunoprecipitation kit (K286-25) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4-nitro blue tetrazolium chloride (NBT) (Roche) overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM DTT and protease inhibitor cocktail (Roche)) to remove unbound protein ...
-
bioRxiv - Neuroscience 2019Quote: ... and BCIP 4-toluidine salt solution (Roche, 11383221001).
-
bioRxiv - Cell Biology 2020Quote: ... and 4-nitro blue tetrazolium chloride (Roche Diagnostics) were used for detection ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes centrifugation at 13000 g at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 complete-EDTA protease-inhibitor tablets (Roche) per 500 mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mM MgCl2) supplemented with protease inhibitors (Roche cOmplete 1 tablet/10 mL ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes of centrifugation at 13000 g at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 μg of DNase I (Roche, 104159) for incubation at 32°C for 15 min with shaking at 53 rpm ...
-
bioRxiv - Biochemistry 2024Quote: ... and phosphatase inhibitor (Roche; 4-906-837-001) on ice for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... transferrin (5 μg/mL) and sodium selenite (5 ng/mL) (Roche Diagnostics, Germany), 100 units/mL of penicillin ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 ug/ul creatine kinase (Roche), 0.1 mM spermidine ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2019Quote: ... probes were synthesized at 37°C for 2-4 hrs in digoxigenin-synthesis reaction mixture with T3 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting supernatant is the soluble fraction and the insoluble fraction is generated by resuspending the pellet in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Roche), 0.5 mM PMSF ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was diluted to 2 ng/µL and 4 µL were added to 10 µL 2x FastStart Universal SYBR Green PCR Master (Roche). Each sample was run in triplicate using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted in PBS for 2 hours at room temperature after which they were counterstained with 300 nM 4’,6’-diamino-2-phenylindole (DAPI; 10236276001, Roche) for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were synthesized at 37°C for 2–4 hrs in digoxigenin-synthesis reaction mixture with T7 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Bioengineering 2023Quote: ... The primary antibodies and respective concentrations used in this study are the following: 4’,6-diamidino-2-phenylindole (DAPI) (1:500, Roche), anti-Ki67 (1:100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were then blocked in blocking solution (maleic acid buffer containing 2% Boehringher-Mannheim blocking reagent) and incubated overnight at 4°C in blocking solution containing anti digoxigenin antibody (Roche) diluted at 1:2000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endogenous peroxidase activity was quenched in 3% hydrogen peroxide (Roche) in PBS for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: Dissected embryos were incubated with a liberase-blendzyme 3 (Roche) solution for 90min at 33 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 3% bovine serum albumin (Roche Diagnostics, Meylan, France) and 1.3 mg/ml collagenase A (Merck ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Physiology 2022Quote: ... This was followed by a perfusion at 4 mL/min for 40 min with the same solution containing 1 mg/mL of collagenase A (Roche Diagnostics GmbH, Mannheim, Germany) plus 300 µM ethylene glycol tetraacetic acid (EGTA ...
-
bioRxiv - Cancer Biology 2019Quote: ... coli cells containing the overexpressed RNF114 fusion protein were re-suspended in 80 mL of lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 2 Roche protease inhibitor tablets [without EDTA] ...
-
bioRxiv - Microbiology 2021Quote: ... and the pellet was resuspended in 1-2 ml of lysis buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; protease inhibitor [Roche]), depending on the size of the cell pellet ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1.5 ml 5 M NaCl, 12.5 μL 2 M Spermidine, final volume brought to 50 ml with dH2O, complemented with one Roche Complete Protease Inhibitor EDTA-Free tablet) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 50 U/ml DNAse I (Roche) in Leibovitz’s L-15 per 0.3 g tissue ...