Labshake search
Citations for Roche :
5351 - 5400 of 6945 citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade D UG28R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... incubated with 1ml MB#1 buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.2% NP-40, 1x Roche cOmplete EDTA-free (Roche diagnostics ...
-
bioRxiv - Genomics 2022Quote: ... Two rounds of washes with Wash Buffer were then performed and nuclei were incubated with ME-A loaded pA-Tn5 diluted 1:200 in 300 Wash Buffer (20 mM HEPES pH7.5, 300 mM NaCl, 0.5 mM spermidine, Roche Complete Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were harvested at indicated time points with RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche: cOmplete mini EDTA-free protease inhibitor ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... Nuclei were then resuspended in 1 mL of Wash Buffer (20 mM HEPES pH7.5, 150 mM NaCl, 0.5 mM spermidine, supplemented with Roche complete EDTA-free protease inhibitor tablet) ...
-
bioRxiv - Molecular Biology 2022Quote: Primary adipocytes were isolated from epi-WAT after digested at 37°C for 1 hr with collagenase (Roche) in KRB supplemented with 3 mM glucose and 1% FA-free BSA ...
-
bioRxiv - Plant Biology 2022Quote: ... resuspended in lysis buffer (20 mM HEPES 150 mM NaCl 20 mM imidazole 1 mM PMSF 0.02% NaN3 pH = 7.4 with Complete protease inhibitor cocktail, Roche) and sonicated on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Plant Biology 2022Quote: ... incubated with proteinase K (1 mg/mL in 100 mM Tris-HCl, pH 8.0, 50 mM EDTA; Roche) at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Neuroscience 2023Quote: The other brain halves (frozen) were homogenized in 1 mL PBS containing complete protease inhibitor (Roche Applied Science) and 1 mM AEBSF (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche) using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... Slides were washed 10 min in washing buffer and incubated 1 h in blocking buffer (both Roche #11585762001). Anti-DIG antibody was added (Roche #11093274910 - 1:1500 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... The nucleus was stained with 4,6-Diamidino-2-phenylindole (DAPI, 1 µg/mL in PBS) (Roche; Basel, Switzerland). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... cOmplete™ Mini Protease Inhibitor Cocktail EASYpacks tablet (1 tablet for 10mL of lysis buffer) (Roche, Cat # 04693124001)) and manually homogenized ...
-
bioRxiv - Neuroscience 2022Quote: ... at 95°C for 60 minutes or with a medium concentration of protease (Protease 1; Roche Tissue Diagnostics) for 4 minutes ...
-
bioRxiv - Microbiology 2022Quote: Cells were washed once with 1xPBS before harvesting in NP-40 buffer with protease inhibitor (200 mM NaCl, 50 mM Tris pH 7.4, 0.5% NP-40 Alternative, 1 mM dithiothreitol, and Roche Complete Mini ...
-
bioRxiv - Cell Biology 2022Quote: ... the chromatin pellet was suspended with buffer B (20 mM Tris-HCl, pH 8.0, 0.5 M NaCl, 10 mM EDTA, and 1× complete protease inhibitor cocktail; Roche), and then mononucleosome was extracted ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed with 1 μg of DNA and KAPA HTP Library Preparation Kit (KAPA Biosystems, #KK8234). Resulting reads (50 base single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 50 mM sodium fluoride, protease inhibitors [Roche]). Triton X-100 (0.1% ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 5% glycerol, 1x protease/phosphatase inhibitor cocktails, Roche). Nuclear lysates were diluted with 2 volumes of dilution buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM PMSF) and supplemented with a protease inhibitor cocktail (cOmplete Protease Inhibitor Cocktail Tablets, EASYpack, Roche). Cells were lysed by sonication on ice (Branson Digital Sonifier 450 ...
-
bioRxiv - Cancer Biology 2024Quote: Whole cell extracts were prepared by lysing cells in RIPA buffer (50 mM Tris HCl pH 7.4/150 mM NaCl/0.5% sodium deoxycholate/0.1% sodium dodecyl sulfate/1% NP-40) containing cOmplete protease inhibitor cocktail (Roche), followed by quantification using Bradford assays ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 2 mM EDTA, containing ‘Complete mix’ protease inhibitors from Roche) and passed 10 times through a 26-gauge needle ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated by lysing cells (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.67% SDS, and 125 μg/ml proteinase K from Roche), followed by incubation 4 hours at 55°C with weak agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Molecular Biology 2024Quote: ... 20% v/v glycerol, 2 mM MgCl2, 0.5 mM EDTA, 0.2% NP40, 1 mM DTT, 1x Complete Protease inhibitors, Roche) and the suspension tumbled at 4 °C for 45–75 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... resuspended in buffer A complete (buffer A with 0.15% NP40, 0.5 mM DTT, 1 x Complete protease inhibitors, Roche), and dounced 40 times ...
-
bioRxiv - Molecular Biology 2024Quote: Site directed mutagenesis of plasmids listed in Table 1 was carried out using KAPA HiFi HotStart premix (Roche) or Tks Gflex DNA polymerase (Takara Bio ...
-
bioRxiv - Plant Biology 2024Quote: ... total proteins were extracted from 2-3 aliquots of 3 g frozen ground Arabidopsis seedling tissue with IP buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1% Triton-X, EDTA-free protease inhibitor cocktail [Roche]). Lysates were cleared by filtering through miracloth followed by centrifugation (6,000 g ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were homogenized in RIPA buffer (dH2O; 1% Igepal; 150 nM NaCl; 0.1% SDS; 0.5% SOD; 50 mM Tris) containing protease inhibitor (Roche) and phosphatase inhibitor (ThermoScientific ...
-
bioRxiv - Neuroscience 2023Quote: ... the brain sections were incubated with peroxidase (POD)-conjugated anti-FITC antibody (Roche Applied Science, Germany; 1:2,000) or POD-conjugated anti-Digoxigenin antibody (Roche Applied Science ...
-
bioRxiv - Genomics 2024Quote: ... Cell pellets were resuspended in 250 µL ice-cold Hi-C lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630, 1 tablet/10 mL Roche complete mini EDTA-free protease inhibitor) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The samples were de-frosted in 1 mL of 1x DpnII buffer with protease inhibitors (Roche cOmplete™), transferred to Precellys VK05 lysis tubes (Bertin Technologies ...
-
bioRxiv - Immunology 2024Quote: ... the cell pellet was re-suspended and incubated in 1 ml of Red Blood Cell Lysis Buffer (Roche) for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... RNA was harvested by removal of culture medium and addition of 200 µl of 1 M DTT (Roche) supplement Kingfisher RNA lysis buffer (Thermofisher) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Immunology 2024Quote: ... nuclei were resuspended in 1mL ST buffer (nuclear flow cytometry, RNAseq experiment 2) or PBS/1% BSA/0.2UμL Protector RNAse inhibitor (Roche) (RNAseq experiment 1) ...
-
bioRxiv - Microbiology 2024Quote: ... and subsequently resuspended in 1 mL of lysis buffer (0.5% NP40, 50 mM Tris–HCl pH 7.4; 150 mM NaCl, 1 mM EDTA, cOmplete protease (Roche) and PhosSTOP phosphatase (Roche ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were prepared from 1 µg of total RNA using a Kapa mRNA HyperPrep kit (Roche, KK8580) per the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... The purified parasites were lysed in 200 μl RIPA buffer (150mM NaCl, 10 mM TrisHCl, pH 7.5, 0.1% SDS, 1% TX100 containing 2x protease inhibitor cocktail (Roche), and 1 mM PMSF ...
-
bioRxiv - Biophysics 2024Quote: ... A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems; 1-μL qPCR template, 15 cycles maximum). We amplified corresponding regions of pSC101_TetR_specR with primers that linearized the backbone ...
-
bioRxiv - Molecular Biology 2022Quote: ... with modifications - membranes were pre-hybridized in a volume of 0.2ml of pre-hybridization solution (5xSSC, 0.1% N-Lauroylsarcosine sodium salt, 1% SDS, 2% Blocking reagent (Roche)) for each 1cm2 of the membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100) complemented with final concentration of 1X EDTA-free Complete protease inhibitor cocktail (34044100, Roche) and 1 mM PMSF (78830 ...
-
bioRxiv - Immunology 2023Quote: ... and the surface was immersed in 200 µl of ice-cooled gut buffer [1× protease inhibitor cocktail (Roche), 0.2 mg/mL trypsin inhibitor from soybean (Thermo fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were then resuspended in sonication buffer (50 mM Tris-HCl pH 8.1; 10 mm EDTA; 1% Triton-X; 0,1% deoxycholate sodium; 100 mM NaCl, 1mM PMSF, Proteinase inhibitor Roche) and sonicated 6 times with 2 min cycles (Branson Sonifier 250 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...