Labshake search
Citations for Roche :
5051 - 5100 of 5184 citations for Lipoteichoic Acid LTA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting PCR products were then used as a template for generation of sense and antisense DIG-labelled probes using a DIG-nucleotide labelling kit (Roche, Indianapolis, IN, USA). Hybridised probes within the nematode tissues were detected using an anti-DIG antibody conjugated to alkaline phosphatase and its substrate ...
-
bioRxiv - Microbiology 2023Quote: First-strand cDNA synthesis and quantitative real-time PCR was performed using the KAPA SYBR® FAST kit (CliniSciences) on the LightCycler® 480 (Roche Diagnostics) using the primers indicated in Supplementary Table S6 ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Libraries were amplified for 13 PCR cycles in 50 μl reactions containing 150 pmol of P1.1 (5’-AATGATACGGCGACCACCGAGA) and P3 (5’-CAAGCAGAAGACGGCATACGAGA) primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... brain sections were processed for DNA strand breaks using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) from Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina adapters (AGA TCG GAA GAG CGT CGT GTA GGG AAA GAG TGT AGA TCT CGG TGG TCG CCG TAT CAT T and AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GACGCT CTT CCG ATC TNN***) were ligated and DNA-cDNA chimeras were then amplified with the KAPA HiFi kit (Roche, Cat. No. 07958838001). PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The levels of βGAL and CAT were measured according to the protocol of the β-Gal Reporter Gene Assay kit (Roche, cat. # 11758241001) and the CAT ELISA kit (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... We used the Agilent Bioanalyzer to assess the quality of the library and a qPCR approach with the KAPA Library Quantification Kit (Roche; P/N: KK4873) on the QuantStudio 12K device to quantify the library ...
-
bioRxiv - Genetics 2024Quote: ... Strand-specific and dual-barcode indexed RNA-seq libraries were generated from 450 ng total RNA each using the Kapa RNA-seq Hyper kit (Kapa Biosystems-Roche, Basel, Switzerland) and both the QIAseq FastSelect–5S/16S/23S ribodepletion and FastSelect rRNA Plant reagents (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... they were quantified on a CFX 384 Touch Real-Time PCR Detection System using the KAPA Library Quantification Kit (KAPA Biosystems, cat. KK4824). Finally ...
-
bioRxiv - Genomics 2023Quote: ... DNA-Seq libraries were prepared from 1 mg of DNA extracted from young leaves using the Kapa LTP library prep kit (Kapa Biosystems, MA, USA). After quantity and quality evaluation with the High Sensitivity chip of a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... was depleted from the total RNA samples using the RiboErase module of the KAPA RNA Hyper+RiboErase HMR Kit (Roche Cat. No. 08098140702). The rRNA-depleted RNA was then applied for library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Pathology 2023Quote: ... was performed with RNAscope® 2.5 VS Reagent Kit (323250, Advanced Cell Diagnostics, Newark, CA) on a Ventana Discovery Ultra platform (Roche Diagnostics, Penzberg, Germany). Sections were exposed to 24 hours antigen retrieval and 16 min protease treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified based on the manufacturer’s instructions before sample barcoding with xGen Stubby Adapter and Unique Dual Index Primers (IDT) and library preparation using KAPA HyperPrep Kit (Kapa Biosystems-Roche, Wilmington, MA). The library was then sequenced by Illumina MiSeq nano PE150 at the Georgia Genomics and Bioinformatics Core ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections as previously described (46) (Iba-1 staining was conducted on a Ventana Benchmark using OptiView and UltraView detection kits provided by Roche (Roche Molecular Systems, Inc). Sections were deparaffinized in xylene and rehydrated through an ethanol series ending in distilled water ...
-
bioRxiv - Pathology 2023Quote: ... The RT-qPCR reactions were performed as recommended by the kit protocol and run on a Roche Light Cycler (Roche, Indianapolis, IN, USA). The limit for cycle of quantification was defined at less than 29 ...
-
bioRxiv - Immunology 2022Quote: Tumor tissue sections were subjected to the terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick-end labeling (TUNEL) assay using the In Situ Cell Death Detection Kit (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digoxigenin-containing RNA probes were generated by in vitro transcription with T7 polymerase using the DIG RNA Labelling kit (SP6/T7) from Roche (cat. No 11175025910). The oligonucleotide AJ529 (T7 promoter ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: Probes for whole mount ISH and FISH were prepared with RT-PCR using primers listed in Table S7 followed by ligation into pGEM-T Easy vectors and transcribed using a DIG RNA labeling kit (Roche, Cat no. 11175025910), some probes were made using flourescein labeling mix (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) before cluster generation.
-
bioRxiv - Zoology 2023Quote: ... Digoxigenin-labeled antisense and sense RNA probes were produced from cloned PCR fragments using a digoxigenin RNA labeling kit (SP6/T7; Roche Diagnostics, Basal, Switzerland). Labeling was performed as previously described (Ukena et al. ...
-
bioRxiv - Physiology 2023Quote: ... Library for RNA-Seq was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kit with 201-300bp insert size (KAPA Biosystems, Wilmington, MA) using 250 ng total RNA as input ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared by the Van Andel Genomics Core from 1ug of total RNA using the KAPA stranded mRNA kit (v5.16) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... Multiplexed library pool QC was based on Agilent Tapestation 4200 HS D1000 and Kapa Library Quantification Kit for Illumina platforms (Kapa BioSystems, Boston, MA) and sequenced at shallow depths on Illumina’s iSeq 100 v2 flow cell for 26×10×10×90 cycles for estimated reads per cell ...
-
bioRxiv - Immunology 2023Quote: ... and adapter-ligated using the KAPA PCR-free Hyper Prep Kit in combination with KAPA Unique Dual-Indexed Adapters (F. Hoffmann-La Roche AG, Basel, Switzerland). Adapter-ligated libraries were purified by AMPure XP bead cleanup ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA mRNA Hyperprep kit (v4.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Genomics 2023Quote: ... Bank validation was done with the quantification of the complementary DNA with the Standard Sensitivity NGS kit on Fragment Analyzer and with qPCR (ROCHE Light Cycler 480). The sequencing was done on NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The concentration of each library was determined by quantitative PCR (qPCR) via the KAPA Library Quantification Kit for Next Generation Sequencing (KAPA Biosystems; Woburn, MA).
-
bioRxiv - Microbiology 2023Quote: ... and the concentration was measured with the Qubit®/Quant-IT® Fluorometric Quantitation and/or KAPA Library Quantification kit for Illumina platform (KAPA Biosystems). Paired-end sequencing (read length 100 bp ...
-
bioRxiv - Immunology 2023Quote: ... following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics, #760-229 and # 760-239). These chromogenic dyes are covalently deposited and have unique spectra (83 ...
-
bioRxiv - Genetics 2023Quote: ... RNA sequencing libraries were prepared as described previously (Ma, Fuqua et al. 2019) using the KAPA Stranded mRNA-Seq Kit (cat #KK8421, KAPA Biosystems, Wilmington, MA). The pooled libraries were sequenced in an Illumina HiSeq4000 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from 500 ng of total RNA using the KAPA mRNA Hyperprep kit (v4.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... We determined the size of the final library construct on the Caliper LabChip GX system and quantified it using qPCR SYBR Green reactions with a set of DNA standards and the Kapa Library Quantification Kit (KAPA Biosystems, Part#KK4854). Size and concentration values were entered into the WikiLIMS database for the sequencing team’s use for appropriate flow-cell loading ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of ligated fragments in each library was quantified with the KAPA Library Quantification Kits for Illumina platforms (Roche/KAPA Biosystems, KK4824) on a Roche LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... The mRNA-seq library was prepared using poly (A)-tailed enriched mRNA at the UT Cancer Genomics Center using the KAPA mRNA HyperPrep Kit protocol (KK8581, Roche, Holding AG, Switzerland) and KAPA Unique Dual-indexed Adapter kit (KK8727 ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and real-time qPCR reaction were carried out with KAPA SYBR FAST One-Step qRT-PCR Master Mix Kit (KAPA Biosystems, Wilmington, MA) on LighyCycler 480 system (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: TUNEL assays were carried out on 10 µm cryosections following the manufacturer’s protocol in the Fluorescein in Situ Cell Death Detection kit (Roche Applied Science, Indianapolis, IN).
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then amplified the adapter-ligated libraries with indexing oligos (Glenn lab, University of Georgia) and the KAPA HiFi PCR Kit (Roche, Indianapolis, Indiana, USA) using 16 cycles of PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) prior to cluster generation ...
-
bioRxiv - Genomics 2024Quote: Library preparation was carried out at the University of Michigan Advanced Genomics Core using the KAPA mRNA Hyper Prep Kit (Roche, Wilmington, MA, USA) with dual indexing adapters ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A volume of 50 µl (1 µg) of sheared DNA from each sample was used for library preparation using a KAPA Hyper Prep Illumina Kit (KAPA Biosystems, Wilmington, MA) and 48 barcoded adaptors (Bioo Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and ligated to iTru adapters followed by limited-cycle PCR of iTru primers to add indexes and complete the library molecules using Kapa Library Preparation Kit reagents (Kapa Biosystems [Roche, Basel, Switzerland]). We sequenced the pooled libraries on an Illumina sequencer (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche cat# KK4824) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was purified from homogenized tissues using a combination of Trizol (Tri Reagent; Molecular Research Centre, Burlington, ON, Canada) and a High Pure RNA isolation kit (Roche Scientific, Laval, QC, Canada) as described previously (30) ...
-
bioRxiv - Developmental Biology 2020Quote: Digoxigenin (DIG)-labeled and Fluorescein (Flu)-labeled in-situ probes were synthesized using in vitro transcription with Flu/DIG RNA Labeling kits respectively (Roche,Cat#11175025910, Cat#11685619910). RNA in-situ hybridization was conducted according to the published protocol 85 ...
-
bioRxiv - Genomics 2019Quote: ... were prepared by ligation of Illumina adapters on 100 ng of amplicons following the Kapa Hifi HotStart NGS library Amplification kit (Kapa Biosystems, Wilmington, MA, USA). After quantification and quality control ...