Labshake search
Citations for Roche :
4951 - 5000 of 8835 citations for FH1 FH2 domain containing protein 1 FHOD1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Cell pellet was collected and re-suspended in lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, Roche complete protease inhibitor ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with HRP-conjugated rabbit anti-sheep antibodies and detection using ECL reagents (Roche Diagnostic GmbH). A series of timed exposures were undertaken to ensure that densitometric analyses were performed at exposures within the linear range ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal mouse anti-HA (MMS-101R; Covance) or monoclonal mouse anti-GFP antibodies (11–814–460-001; Roche) prior to secondary antibody treatment with polyclonal goat anti-mouse conjugated to horseradish peroxidase (115–035-146 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The expression of KZFP was verified by western blotting with the HA-specific antibody (Roche, Basel, Switzerland; #12013819001). Empty vector-transduced A549 cells (referred to as negative control cells (NC cells) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lysate was incubated with agarose beads conjugated with either mouse IgG or mouse anti-GFP antibodies (Roche) for 3h at 4°c under gentle agitation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were then stained for HMGXB4-HA and HMGXB4SUMO -HA using a HA tag antibody (Roche Applied Science) and Fibrillin with Anti-Fibrillin 1 antibody (abcam ...
-
bioRxiv - Microbiology 2020Quote: ... IFAs were carried out on methanol-fixed cells using primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:100 and rabbit α-PfHP1 12 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cancer Biology 2021Quote: ... The detection kit for the antibodies is the UltraView DAB detection Kit (Ventana Medical Systems Inc./ Roche Diagnostic). A counter-staining of the nuclei was used for 12 minutes by Hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... was used to remove excess antibody and amplified C-circles were detected with CDP-Star® kit (Roche). Membranes were imaged with the Odyssey® Fc Imager (LI-COR ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Immunology 2023Quote: ... in antibody buffer (20 mM HEPES pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1X Protease inhibitor cocktail (Roche); 0.05% Digitonin ...
-
bioRxiv - Genetics 2023Quote: ... Cells were incubated overnight in primary antibodies targeting GFP to stain GFP labelled CTCF or RAD21 (Roche, 11814460001) or SON (abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... sorted cells were washed with PBS and resuspended in Antibody Buffer (1X eBioscience Perm/Wash Buffer, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Systems Biology 2023Quote: ... subsequently transferred to polyvinylidene fluoride membranes and probed with the anti-GFP primary antibody (Roche, Mouse monoclonal, #11814460001) and goat AffiniPure anti-mouse IgG (H+L ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an anti-DIG antibody coupled to alkaline phosphatase (Anti-Digoxygenin-AP, Fab fragments, Roche), whose activity was detected by the chromogenic method using NBT/BCIP (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridized probes were detected by anti-DIG antibodies conjugated with alkaline phosphatase enzyme (anti-DIG-AP) (Roche, Germany). Photographs were captured using an Olympus BX51 compound microscope using a DP74 Olympus camera.
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 20% of the elution sample volume was analyzed by western blotting with α-HA tag antibody (#3F10, Roche) for Sly1-HA immunodetection.
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was first performed with high or low pH buffer depending on the primary antibody (CC1m, Roche or low pH antigen retrieval buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... probes were detected using anti-digoxigenin and anti-fluorescein antibodies with Fab fragments conjugated to horseradish peroxidase (Roche). 1:500 fluor-tyramide (TAMRA or FAM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Detection of DIG-labeled probes were performed by incubation with a mouse monoclonal anti-DIG primary antibody (Roche), followed by incubation with Cy3-labeled goat anti-mouse IgG secondary antibody (EMD Millipore) ...
-
bioRxiv - Immunology 2024Quote: ... CD3 primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 570 (NEL871001KT ...
-
bioRxiv - Immunology 2024Quote: ... CD11c primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 690 (NEL871001KT ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl and 0.1% (v/v) Tween 20] and probed with anti-GFP mouse monoclonal antibodies (Roche) followed by goat anti-mouse horseradish peroxidase (HRP ...
-
bioRxiv - Cell Biology 2024Quote: ... Detection was carried out using horseradish peroxidase-conjugated secondary antibodies and enhanced chemoluminescence (Roche Diagnostics, Germany/Advansta, USA). Densitometric analysis was performed using ImageJ.
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in a protoplast buffer (100 mM Tris-HCl pH 7.5, 2 mM MgCl2, 1M Sucrose, 6 μg/mL of DNAse/ RNAse, 1x protein inhibitor Roche, 800 U mutanolysin, 8 mg/ml lysozyme) and incubated at 30°C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 1× Roche protease inhibitor cocktail) and incubated on ice for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed cells were washed with cold PBS two times and harvested in 1 % Triton X-100 in PBS buffer with 1 mM EDTA and Complete protease inhibitors (Roche). The lysates were centrifuged at 14,000 rpm for 15 minutes and the supernatant mixed with Strepavidin Sepharose High Performance (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... An equal volume of hypertonic lysis buffer (HEPES 20 mM, NaCl2 500 mM, MgCl2 1 mM, Glycerol 10%, DTT 1 mM, 1x Complete protease inhibitor [Roche]) was then added to the lysate ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed in PBS and resuspended in 0.5 mL lysis buffer (10 mM Tris-HCl pH 8.0, 50 mM NaCl, 15 mg·mL-1 lysozyme, 1× protease inhibitor (Roche, Bavaria, Germany) and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit anti-BALL (Gift from A. Herzig, IF 1:20, ChIP: 2μl) mouse anti-GFP (Roche, 11814460001, IF:1:50), mouse anti-Tubulin (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... the SARS-CoV-2 containing cell culture supernatant was mixed (1:1 ratio) with the Lysis Binding Buffer from the Magnapure LC Kit # 03038505001 (Roche) to inactivate the virus ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris/HCl, 150 mM NaCl, 1 mM EDTA supplemented with 1 × protease inhibitor cOmplete Mini EDTA-free mixture from Roche) and subjected to WB assay.
-
bioRxiv - Molecular Biology 2021Quote: ... and then resuspended in 200 μL of SCE buffer (1 M sorbitol, 10 mM EDTA, 10 mM DTT, 100mM sodium citrate, 1 Roche mini-EDTA-free protease inhibitor tablet per 50 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 mM KCl, 10 mM MgCl2, 1% Triton-X100, 100 ug/ml cycloheximide, 1 mM DTT, complete EDTA-free protease inhibitors – Roche) plus 500 uL acid-washed glass beads (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by sonication in 250 ml of 1% sodium dodecyl sulfate and 1× cOmplete protease inhibitor mixture (Roche, Indianapolis, IN) in PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in complete media (DMEM with 10% FBS and 1% antibiotics) supplemented with Collagenase-D (1 mg/mL; Roche) and incubated at 37°C for 30 min with shaking to form a single-cell suspension ...
-
bioRxiv - Biophysics 2022Quote: ... The pellet was resuspended in a 1:1 ratio (w/v) in PB supplemented with Complete Protease Inhibitor Cocktail (Roche) and afterwards dropwise frozen in liquid nitrogen before lysed in 6875D LARGE FREEZER/MILL® (SPEX SamplePrep LLC) ...