Labshake search
Citations for Roche :
451 - 500 of 3695 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... All primers that were used introduced EcoRI (Roche) and BamHI (Roche ...
-
bioRxiv - Physiology 2021Quote: ... with primers detailed below on LightCycler480 apparatus (Roche). Gene expression levels were normalized with hypoxanthine phospho-ribosyltransferase (HPRT) ...
-
bioRxiv - Immunology 2020Quote: ... 0.5 μg PolyT primer for cDNA synthesis (Roche) and RNasin inhibitor (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... Primer sequences and corresponding probes (Metabion, Roche & TipMolBIOL) are listed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and specific primers on the LightCycler 96 (Roche). Relative target gene expression was determined by comparing average threshold cycles (CT ...
-
bioRxiv - Cancer Biology 2023Quote: ... with primers detailed below on LightCycler480 apparatus (Roche). Gene expression levels were normalized with hypoxanthine phospho-ribosyltransferase (Hprt) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gene-specific primers and probes (Universal ProbeLibrary, Roche) were used in combination with qPCR Probe-MasterMix (SL-9802 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and specific primers on the LightCycler 96 (Roche). Relative target gene expression was determined by comparing average threshold cycles (CT ...
-
bioRxiv - Developmental Biology 2020Quote: ... The library pool was hybridized with a custom Nimblegen probe set (Roche), targeting protein-coding regions and non-coding RNAs (lncRNAs and miRNAs) ...
-
bioRxiv - Genetics 2021Quote: ... and indexed with KAPA Single-Indexed Adapter Set A + B (Kapa Biosystems). Library quantification was by Qubit 1x dsDNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and hybridization probes from the Universal Probe Library Set (Roche Life Sciences). The relative expression ratio of target/reference gene was calculated with the ΔΔCt method (Pfaffl 2001) ...
-
bioRxiv - Neuroscience 2021Quote: ... The sequences of the specific forward and reverse primer pairs were constructed using the Primer-BLAST tool or using the “Universal Probe Library” software (Roche Diagnostics). Sequences of the different primer pairs used are listed in Supplementary Table S1 for humans and Supplementary Table S2 for rats ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized from total RNA with anchored-oligo(dT)18 primer and random hexamer primer using Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). The template-primer mix was denaturized at 65 °C ...
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesised from the total RNA with anchored-oligo(dT)18 primer and random hexamer primer using Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). One μg of RNA was added to each 20 μl RT reaction ...
-
bioRxiv - Cancer Biology 2019Quote: Reverse transcription (RT) reactions were carried out using 1 μg of RNA using Transcriptor RT enzyme (Catalog No. 03531287001) from Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2019Quote: ... avian myeloblastosis virus reverse transcriptase (AMV RT; Roche) were used to synthesize cDNA from total RNA (2.5 µg ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was performed on a LightCycler480 (Roche) in a 10-μL reaction mixture containing 8 ng of cDNA ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR was run using SYBR green (Roche) on a QuantStudio 6 (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using SYBR Green (Roche) and a QuantStudio 7 Flex (Life Technology ...
-
bioRxiv - Plant Biology 2019Quote: ... Using RTS 100 Wheat Germ CECF Kit (Roche), GUN1 protein was expressed in RTS ProteoMaster (Roche) ...
-
bioRxiv - Plant Biology 2019Quote: ... GUN1 protein was expressed in RTS ProteoMaster (Roche). Full-length GUN1 cDNA and N-terminal truncated versions as EcoRI-SalI PCR fragments were ligated into pET48b (Novagen ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-HA (rt, 1:1000, Roche, clone 3F10), anti-CNG channel (ms ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was run on Lightcycler 480 (Roche) using SYBR Green 1 Master Kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... or RevertAid RT (Thermo) with random hexamers (Roche). qPCR was performed with the SensiFAST No-ROX Probe Master Mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR experiments were performed with primers designed via the Primer-BLAST tool on the NCBI website and SYBR-Green (Roche, Cat#: 04707516001) in a Roche LightCycler 480 Instrument II to quantify the results ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were blocked in blocking solution (Roche DIG wash and block buffer set) diluted in 1x maleic acid for 1h at RT and riboprobes were detected by incubating in anti-digoxigenin-AP antibody (1:2000 in 1% sheep serum ...
-
bioRxiv - Microbiology 2021Quote: ... Temperature cycling conditions were set on a LightCycler® 480 Instrument II (Roche), using the following parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR reactions were set up using FastStart Essential DNA Green Master (Roche, #06402712001) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2022Quote: ... Transcription reactions were set up to label probes with digoxigenin (DIG, # 11277073910, Roche) and incubated at 37°C for two hours ...
-
bioRxiv - Biochemistry 2023Quote: ... The blot was then developed with DIG wash and block buffer set (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primers (Oligomer) and probes (Oligomer and Roche Applied Sciences) were ...
-
bioRxiv - Biochemistry 2020Quote: ... Details of primers and Universal Probe Library probes (Roche) and primers used can be found in Table S1.
-
bioRxiv - Biochemistry 2020Quote: ... Details of primers and Universal Probe Library probes (Roche) can be found in Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with primer-appropriate Universal ProbeLibrary probes (Roche, Basel, Switzerland) and the ABI 7500 FAST qPCR system (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... using gene-specific primers and KAPA SYBR (KAPA Biosystems), on a Bio-Rad CFX96 real-time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... Primers were designed using the Universal Probe Library (Roche, https://lifescience.roche.com/en_de/brands/universal-probe-library.html#assay-design-center ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers were designed using Universal Probe library from Roche Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... Complementary DNA (cDNA) was synthesized using random primers (Roche) and the High-Capacity cDNA Reverse Transcription kit (Life Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... and primers (Table SE4) in a LightCycler 96 (Roche). Melt curves were used to confirm a single amplification product and the LightCycler 96 Application Software (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RT-qPCR was performed after addition of SybrGreen (Roche). Expression relative to a normalization gene was calculated from Ct values according to the efficiency and delta delta Ct method ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR were performed using Light Cycler 480 (Roche) with the Light Cycler 480 SYBR Green I Master Kit (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR was performed with a LightCycler480 II (Roche). Relative gene expression was determined with the comparative CT method ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT-qPCR analysis was performed using SybrGreen (Roche) to detect PIP4K2B expression ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-qPCR was run on a Lightcycler 480 (Roche) and Ct values obtained using the second derivative ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...