Labshake search
Citations for Roche :
451 - 500 of 10000+ citations for Trisodium dichloroanthra 2 1 9 mna naphth 2 3 h acridine 5 10 15 triyl tris sulfate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 µl of qPCR reaction mix containing 5 ul LightCycler 480 Probes Master (Roche, Cat#04707494001), 3.4 ul of Nuclease Free H2O (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... and resuspended in 100 μl of protein breakage buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA pH 7.5, 2.75 mM DTT, 1 x Roche EDTA-free protease inhibitors) and one volume of glass beads (0.5mM zirconia/silica glass beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed in ice-cold PBS and lysed (1% SDS, 10 mM Tris-HCl, 1 mM NaVO3, cOmpleteTM Mini Protease Inhibitor (Roche, #11836153001), pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were lysed for 10 min on ice in 3 ml ChIP lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris pH 8.1, 1 mM PMSF, 1,5x Roche protease inhibitor mix). The DNA was sheared by sonication (4x 7 cycles ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... Cells were grown to ∼80% confluency, washed in PBS and lysed (1% SDS, 10 mM Tris-HCl, 1 mM NaVO3, and protease inhibitors (Roche, #11836153001), pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... pH 7.5) with the addition of 2 mg·ml-1 collagenase (Roche, Indianapolis). Defolliculated oocytes were injected with ENaC cRNAs into the cytosol (25 ng per oocyte in 50 nl of RNase-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... nuclei were stained with 4,6 diamine-2-phenylindole (1:25000, DAPI, Roche) in PBS 1X for 1 minute ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 50 mM Tris pH 8.5, 40 mM chloroacetamide, 5 mM TCEP; freshly added: 1 tablet Phosphostop [Roche, 4906845001] and 1 tablet cOmplete Protease inhibitor cocktail [Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were lysed in 8 M urea buffer (8 M urea, 1 M Tris pH 7.4, 5 M NaCl) containing protease and phosphatase inhibitors (Roche) followed by sonication at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... the cell pellet was resuspended in 750 μl Tris lysis buffer (50 mM Tris, 0.2% NP-40, 150 mM NaCl, 5 mM EDTA, 5.7 mM PMSF, and 1 x Roche cOmplete). For whole organ samples (either whole detunicated testis or thymus) ...
-
bioRxiv - Cell Biology 2024Quote: Cells or tissues were washed with PBS and lysed in an appropriate amount of protein lysis buffer (TritonX100 -1%, Tris 7.4 -50mM, EDTA -5mM, NaCl -150mM, and glycerol -5%) containing Protease Inhibitor Cocktail (Roche). We used Phosphatase Inhibitor Cocktail (Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Dynabeads™ were washed once with 2 ml of PBS and coated with 15 μg of mouse monoclonal anti-GFP antibody (Roche Applied Science). The beads were finally washed three times with 2 ml of lysis buffer and added to the whole cell extract for a 2 h incubation with gentle rotation ...
-
bioRxiv - Physiology 2024Quote: ... fixed with 4% PFA for 15 min and stained with 4′,6-diamidino-2-phenylindole (DAPI) (0.1 µg/mL; Roche, cat no. 10236276001) for 10 min at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of sample was mixed with 10 µL 2X SYBR Mix (Kapa Biosystems, Wilmington, MA), 0.4 µL of each 10 µM primer (IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
bioRxiv - Developmental Biology 2022Quote: ... fixed in 2% PFA diluted in HM supplemented with PhosSTOP (04906837001 Roche, one tablet/10 ml) for 15 hours at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (2 mM activated Na3VO4, 2 mM NaF and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... plates were fixed with 2% paraformaldehyde/ 2% sucrose and stained with DAPI (#10236276001, Roche). Plates were photographed with the IN Cell Analyzer 2200 high content analyzer (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Tween-20] and maintained for 2 hours in 2% blocking reagent (11096176001, Roche) in TNT ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 10 µg sgRNA plasmid using X-tremeGENE™ 9 DNA transfection reagent (Roche 06365809001). One day after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 49 were resuspended in 25μL 10% sodium dodecyl sulfate solution with a protease inhibitor cocktail (Roche). Reduction of disulfides was performed by adding dithiothreitol (DTT ...
-
bioRxiv - Cancer Biology 2021Quote: ... control and Capecitabine treated tumors were digested for 2 h at 37 °C with a cocktail of Collagenase I (Roche, Ref: 11088793001) and Hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was discarded and the pure nuclear pellets were resuspended in boiling buffer (100mM Tris pH8.0, 2% SDS, 100μM PUGNAc, and Roche EDTA-free protease inhibitor cocktail) [59] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% NP40 and 10 mM Tris (pH 7.5)) supplemented with cOmplete EDTA-free protease inhibitor (Roche, Basel, Switzerland). Samples were incubated on ice for 10 minutes ...
-
bioRxiv - Genomics 2021Quote: ... Cells were lysed by the addition of 1000 μL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.0, and 0.25× protease inhibitor cocktail [Roche]). Cells were sonicated on ice to generate an average DNA fragment size of ∼250 bp ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 * 107 cells were pelleted and resuspended in 1 ml of lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) including 0.25x protease inhibitor (Roche)) ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... The cell pellet was resuspended in 1 mL ChIP lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-Cl, pH 8.0, and 0.25 x protease inhibitor cocktail [Roche]) and transferred to Beckman Coulter 4mL Polycarbonate Thick Wall Centrifuge Tubes (13 × 64 mm) ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... Cell pellet was resuspended in 1 mL ChIP lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-Cl, pH 8.0, and 0.25 x protease inhibitor cocktail [Roche]) and transferred to Beckman Coulter 4mL Polycarbonate Thick Wall Centrifuge Tubes (13 × 64 mm) ...
-
bioRxiv - Genomics 2022Quote: ... twice 10 min with cold TET buffer (10 mM Tris/HCl pH7.5, 1 mM EDTA, 0.1% Tween-20, protease inhibitor cocktail (Roche)) and eluted with TE buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Tris, pH 7.5, 1 mM EDTA, 0.5% Nonidet P-40, protease and phosphatase inhibitor cocktail [Roche]). Cell lysates were denatured in Laemmli sample buffer and incubated for 5 min at 95°C ...
-
bioRxiv - Microbiology 2022Quote: ... were incubated at 4°C with hypotonic lysis buffer (10 mM Tris–HCl pH 8.0, 1 mM KCl, 1.5 mM MgCl2, with protease inhibitors (ROCHE)) for 2 hours while rotating ...