Labshake search
Citations for Roche :
451 - 500 of 1063 citations for Fatty acid binding protein FABP3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... protease inhibitors) and precleared with protein A beads (Roche) at 4 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... Immunoprecipitations were performed using Protein A agarose beads (Roche). DivJ was immunoprecipitated using an anti-DivJ antiserum (15) ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were semi-dry blotted onto PVDF membranes (Roche), which were subsequently blocked in 5 % milk in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by incubation with Protein G beads (Roche, 1124323301) for 2 hours at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were transferred onto polyvinylidene fluoride (PVDF) membrane (Roche) for 30V for 16 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... The proteins were reduced using 10 mM dithiothreitol (Roche) and alkylated with 50 mM iodoacetamide ...
-
bioRxiv - Neuroscience 2021Quote: ... Then homogeneous protein G-agarose suspension was added (Roche) to the suspension ...
-
bioRxiv - Pathology 2019Quote: ... Proteins were detected using polyclonal antibodies against GFP (Roche), Histone H3 (GeneTex ...
-
bioRxiv - Plant Biology 2021Quote: ... coupled to 50µl bed volume Protein A agarose (Roche) per sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 mM DTT and 1x protein inhibitor cocktail (Roche), and incubated at 25ºC for 1 h on a rotating wheel ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by incubation with protein G-agarose beads (Roche) for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were transferred onto PVDF membranes (Roche, Basel, Switzerland), and Western blot detection was carried out as previously described [32,33] ...
-
bioRxiv - Biophysics 2020Quote: ... The proteins were reduced using 10 mM dithiothreitol (Roche) and alkylated with 50 mM iodoacetamide ...
-
bioRxiv - Microbiology 2022Quote: ... The proteins were reduced using 10 mM dithiothreitol (Roche) and alkylated with 50 mM iodoacetamide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following electrophoretic transfer of proteins onto PVDF membranes (Roche), nonspecific binding was blocked by incubation with 5% BSA ...
-
bioRxiv - Cancer Biology 2023Quote: ... 400 µg of protein were reduced using DTT (Roche, Cat#10708984001 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and incubated with protein A agarose beads (Roche, #11134515001) at 4 °C overnight with shaking ...
-
bioRxiv - Cell Biology 2019Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA probes complementary to human METTL7B cDNA (NM_152637.2) were labeled with digoxigenin-UTP (Roche). After acetylation ...
-
bioRxiv - Genetics 2022Quote: ... Probes were then mixed with 20μg of COT Human DNA (Roche, 11 581 074 001) and 79μg of Salmon sperm DNA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Human periocular skin was digested in 2.4 U/ml dispase type II (Roche, Basel, Switzerland) at 4 °C for 12 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Cell Biology 2019Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and ethanol precipitated with human Cot-1 DNA (Roche, Germany) and herring sperm DNA (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche, Welwyn Garden City, UK) or placebo (PL ...
-
bioRxiv - Cancer Biology 2023Quote: ... and retrotranscribed cDNA quantified using the Universal Human Probe Roche library (Roche-Diagnostics, Barcelona, Spain). Assays were made in triplicate and normalized to TBP expression (ΔΔCT method) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total protein were extracted from cells and tissues using protein lysis buffer supplemented with protease and phosphatase inhibitors (Roche Applied Science, Penzberg, Germany). Protein concentrations were assayed by the Pierce™ BCA Protein Assay Kit (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Neuroscience 2021Quote: ... human iPSC-derived neuronal cultures and N2a cells were collected in Lysis Buffer (50 mm Tris-Base, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid) with protease inhibitor (Roche) and phosphatase inhibitor cocktails II and III (Sigma ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For protein extraction cells were resuspended in protein extraction buffer (1xPBS, 10% glycerol, 1mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail), and lysed in a bead beater ...
-
bioRxiv - Plant Biology 2019Quote: ... Protein extract was incubated overnight with anti-HA antibodies (Roche). After over-night incubation ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatants were incubated with 30 µl Protein G-Agarose (Roche) per ml lysate for 1 hour at 4 °C and washed three times with lysis buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by incubation with Protein G Agarose beads (Roche, 1124323301) (15μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 μl bed volume of Protein A Agarose (Roche 11134515001) was added the following day to each sample ...