Labshake search
Citations for Roche :
451 - 500 of 6556 citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Immunology 2020Quote: Gene expression levels were determined by triplicate using 113 ng of the cDNA and the pair of oligos for each gene in plates 96 optical Wells LightCycler 480Multiwell plates 96/384 Clear (Roche Applied Science, Mannheim, Germany), using 18s and Cyclophilin as constituent controls ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plates were then coated with laminin solution (Roche, 11243217001) for 2 hours at 37°C and kept ready for use ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5000 cells were seeded in a 96 E-plates (Roche) and the electrical impedance was acquired every 15 minutes for seven days to establish a cell index value extracted from the linear regression of the proliferation curve ...
-
bioRxiv - Biochemistry 2020Quote: ... using a 384-well plate with an optical film (Roche).
-
bioRxiv - Molecular Biology 2021Quote: ... plates were washed and incubated with streptavidin-HRP conjugate (Roche) for 30 mins ...
-
bioRxiv - Neuroscience 2021Quote: ... Plates were sealed by LightCycler® 480 Seal Foil (Roche Life Science ...
-
bioRxiv - Physiology 2021Quote: ... instrument using LightCycler 384-well plates with sealing foil (Roche). The reaction volume of 10 μl contained ...
-
bioRxiv - Plant Biology 2021Quote: ... in 384-wells plates on a Lightcycler LC480 apparatus (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... mEpiSCs passaged off MEF-coated plates onto fibronectin (Roche 11051407001) coated plates for a single passage using StemPro™ Accutase™ to avoid MEF contamination ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 96-well white plate (Roche, cat. no. 4729692001) using a LightCycler480 (Roche ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from culture plates using Tri Reagent (Roche) and isolated using Direct-Zol RNA miniprep kits (Zymo Research) ...
-
bioRxiv - Immunology 2023Quote: ... the plate was incubated with Streptavidin-POD conjugate (Roche, 11089153001) for 1h at RT ...
-
bioRxiv - Physiology 2024Quote: ... instrument using LightCycler 384-well plates with sealing foil (Roche). The reaction volume of 10 μl contained FastStart Essential DNA Green Master Mix (2X ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Immunology 2019Quote: ... After blocking for 1 hour in 3% Bovine Serum Albumin (Roche) in TBS-T ...
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...